top of page

mmu_circBptf_3433

Basic information of circular RNA
PanCircBase ID:

mmu_circBptf_3433

mm39_Chr. Position ID:

chr11|106963508|106973526|-

Gene name:

Bptf

Transcript:

ENSMUST00000057892.15

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

7

Exon/intron indexes:

11,10,9,8,7,6,5

Exon/intron offsets:

0,3839,4977,5837,8040,8533,9830

Genomic length:

10018

Exon/intron sizes in nt:

2308,180,139,130,132,356,188

Flanking exon/introns:

chr11:106959225-106963508|chr11:106973526-106986541

Splice length:

3433

Other database IDs:

circAtlas: mmu-Bptf_0014

Human Ortholog IDs:
Mature spliced Sequence:

GTGATTTCAGACTGGAGAAGTCCAATGGAGAAGTTTCCGAGTCCCCTGGAGCTGGGAAAGGAACATCTGGGTCCACTCGTATCATCACCAGACTGAGGAACCCGGAGAGCAAACTCAGTCAGCTCAAGAGTCAGCAGGTGGCAGCTGCAGCCCATGAAGCAAATAAATTGTTTAAGGAGGGGAAAGAGGTGCTGGTGGTTAACTCCCAAGGAGAGGTTTCACGGCTGAGCACCAAAAAGGAGGTGGTCATGAAAGGGAACATCAACAACTATTTTAAGCTGGGACAAGAAGGGAAGTATCGAGTCTACCACAATCAATACTCGACCAATTCATTTGCTCTGAATAAACACCAGCACAGAGAAGACCATGATAAGAGGAGGCATCTTGCACATAAATTCTGTCTCACTCCAGCTGGGGAGTTCAAATGGAACGGGTCTGTTCACGGGTCCAAAGTCCTTACCATCTCAACCCTGAGACTCACCATCACACAGCTAGAGAGCAACATTCCTTCATCCTTCCTTCACCCCAATTGGGCTTCACACAGGGCTAATTGGATCAAGGCCGTTCAGATGTGTAGTAAACCCAGAGAGTTTGCGTTGGCTCTCGCAATTCTGGAGTGTGCAGTTAAGCCAGTTGTGATGCTGCCAATATGGCGGGAGTCTCTAGGACATACCCGGTTACATAGGATGACATCAATTGAAAGGGAAGAAAAAGAGAAAGTTAAAAAAAAGGAGAAAAAACAAGAGGAGGAGGAGACAATGCAGCAGGCCACATGGGTAAAATACACATTTCCAGTGAAGCACCAGGTTTGGAAACAGAAAGGTGAGGAGTACCGAGTGACAGGGTACGGCGGCTGGAGCTGGATTAGCAAGACGCACGTTTACAGATTTCTTCCCAAGTTACCAGGAAACACGAATGTAAACTACAGAAAGCCCTTGGATGGAGCCAAAAACAATACAGATGAAAATAAAGATGAGTCAGAGAAAAGGAAAAGTCCACGAAGTCCAAAAAAAATGAAGACAGAATGTGATTCTGAACAAGGTGAGACCAGAGATGCAGATGCCACAGCTGGAGCCGCCGCAGGGGCAATGGAGCTGTCTAAGGAACCTGAGAAGAAGGATCAAGATGTAAAAGAACTTTTAGATTCTGATAATGACAAATCCTTCAAGGAAGAACCAATGGAGATCGATGATACCATAAAAACAGAGTCACACGTGAGCAGTCTGGAAAGCACAGAGGTAGATGTAGTCAATGTTAGTGAGGGCTTCCATCTAAGGACTAGTTACAAAAAGAAAACGAAATCCTCTAAGCTGGACGGGCTTCTGGAACGGAGGATTCGACAATTTACACTGGAAGAAAAACAGCGTCTTGAGAAGTTAAAGCTGGAGAGTGGGGTGAAGGGGGCGGGGAAGCCCCCCATGGGTGCTCTGAAAAGCTCCTCTGAGTCTCCAGGCTCCACAAAAGCAAGCGAAGGGCATCAGGGTGACTCGCTGAGACAGGAACAAAGCCCCAGTTCAAGTCAGGCTAGCACTGTGGACTTGGGGCTGGGGGGCTCACAAAGTGATCCCTTGGTTCTTGGCATCAGTCCTCCTAGTCTAAGCACGCACAAACCTGATCCAAAAGATCAAGTATTAGATGATGTCTCCATTCAGAGTCCAGGGCCAAACTGTCAGAGGCAAAACTCAGTTGAAAGCGACCTAGATGCCAGGATCTCTGAACCTGCCGGTAAGGGACTGGAACTAAGTCAGACTAAAACAGAAGTGACTGACTCTTCCTCTGATGACTCTAAACCAACCAGTGCAGACGATGTTGGCATTTTGATCTGTAAGAGCAGAAAGCTGCACTCACAGGACGATAGCAGCACCGTTGTGTCTTCTTCCAAGAGTACTTTACCTGCATCAGTACCTAAAAGTCCCCGTGACAGAGATGCCCGGGCCTTCTCAAAAGCAGTGGACTTCGATGGGAGACTAGGTGGTGACTCTGAATATAGTAGCACTTTGGAAAATAGCTCTGATAATATGTGTATTCGGGACAGTGCTGAAGAAGATATGGTTGTTCAGAACAGCAGTGAAGCCACCTCGAAACGGTTCATAGCTCCAGAACAAGGAGGAGAAAGCGTGGAGTCGACAAAATGTCAGGTAGTTTCTAAGTCCACTGAAAACTGTGAAGACAAACTACAGGGTAAGGTAACTGAAGCAAACGGTAAGAAACTGGGCCAACATCCTCCAAAGCCAGAGGAGAGAGCAGTTAACAGATGTACTGACCAAGTCAGCCTGCGACACAGCGTTGACAGAAAGAACAGTGAACCTCGAGAGTCTGAAAAGAAAGGACAGAAAGCAAATAAATTTCAAATAAACGGCAAAGATAGCAAAGCTAAGGGGTACCTGAAGGGGCCGGGCACGAAGGACGGCTCTGATGGTAAAGTTGTGAGTAGTGCTGTAGAACCAAAGGTCAATAATATCAATAAAGTCATCCCTGGGAATACCAAGTCACTGGCTGGGAAGGAATCTGCTGCGAAGCCGTTCATCAACGGTGACATCATTATGGAAGAGTTGAGTGAACAAAACACTTCAGAAACCAACTCATACTCACTGAGTTCTTCAGATGCCAAAGGTAATCACCAAGATGGCCTCCATACCCTACCATCCACCAAAGAGTCTGCCAGTACCCAGGTAATCACACCCCGAGCCCCTTGTCCAGATCGGAACTCACTTAGTCAGGTAGAAGATATGGAAACTGAAAGTCCAGAGGTTAAGAGAGTTATCCCGTCTCCTGTTAGAACTGGAGAGGGCTCTAACCTTAGCAAGGGCTTCATGGATGACAATGGACTGCCTTCCAGCAAAGACGAGAACGTCAATGGAGAATCCCAAAGAAAGACGGTCATCACAGAAGTCACCACAATGACATCTACTGTTGCCACAGAATCAAAAACTGTCATTAAGGTAGCAAAAGGAGACAAGCAAACTGTGGTTTCTTCCACAGAAAATTGTGCCAGATCCACAGTCACAACTACCACTACCACTGTGACAAAGCTCTCCACACCCTCCCCAGACACCGGTGTGGATACCATCTCTGTAAAGGAGCAGAGTAAAACCGTGGTCACCACGACAGTGACGGACTCCTTGACCACTGCAGGAAGCACACTGGTGACATCTATGACCGTGAGCAAAGAGTACTCCACGAGAGACAGGGTAAAGCTGATGAAGTTCTCACGACCCAAGAAGACCCGCTCAGGCACTGCCCTGCCGTCCTATAGGAAGTTCGTTACCAAGAGCAGCAAAAAGAGCATATTTGTGTTACCTAATGATGACTTGAAAAAGCTGGCCAGGAAAGGAGGGATCCGGGAGGTCCCTTACTTTAATTATAACGCGAAACCTGCCTTGGATATATGGCCATACCCTTCTCCTAGACCGACCTTTGGTATCACATGGAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

CGCGAAACCTGCCTTGGATA

60.74

CGAGTGGACCCAGATGTTCC

60.11

145

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

ATAACGCGAAACCTGCCTTG

59.2

CGAGTGGACCCAGATGTTCC

60.11

149

PCR template sequence:

GAGGGATCCGGGAGGTCCCTTACTTTAATTATAACGCGAAACCTGCCTTGGATATATGGCCATACCCTTCTCCTAGACCGACCTTTGGTATCACATGGAGGTGATTTCAGACTGGAGAAGTCCAATGGAGAAGTTTCCGAGTCCCCTGGAGCTGGGAAAGGAACATCTGGGTCCACTCGTATCATCACCAGACTGAGGAA

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

40

Interacting miRNAs (#binding sites)

mmu-miR-680(3), mmu-miR-211-5p(2), mmu-miR-339-5p(2), mmu-miR-10a-5p(2), mmu-miR-136-5p(2), mmu-miR-1904(2), mmu-miR-9-5p(1), mmu-miR-20b-5p(1), mmu-miR-15a-5p(1), mmu-miR-27b-3p(1), mmu-miR-27a-3p(1), mmu-miR-106a-5p(1), mmu-miR-93-5p(1), mmu-miR-20a-5p(1), mmu-miR-17-5p(1), mmu-miR-32-5p(1), mmu-miR-375-3p(1), mmu-miR-103-3p(1), mmu-miR-34c-5p(1), mmu-miR-34a-5p(1), mmu-miR-101a-3p(1), mmu-miR-204-5p(1), mmu-miR-106b-5p(1), mmu-miR-222-3p(1), mmu-miR-138-5p(1), mmu-miR-10b-5p(1), mmu-miR-139-5p(1), mmu-miR-127-3p(1), mmu-miR-676-3p(1), mmu-miR-22-3p(1), mmu-miR-483-5p(1), mmu-miR-182-5p(1), mmu-miR-370-3p(1), mmu-miR-34b-5p(1), mmu-miR-107-3p(1), mmu-miR-29b-2-5p(1), mmu-miR-129-5p(1), mmu-miR-207(1), mmu-miR-335-3p(1), mmu-miR-296-3p(1)

siRNAs for circular RNA silencing
Junction sequence

GTATCACATGGAGGTGATTTCAGACT

siRNA sets

TCTGAAATCACCTCCATGT

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCBPTF_3433_ORF_1

0.9906

0.192064969

0.999999998

3189

ORF sequence:

ATGAAAGGGAACATCAACAACTATTTTAAGCTGGGACAAGAAGGGAAGTATCGAGTCTACCACAATCAATACTCGACCAATTCATTTGCTCTGAATAAACACCAGCACAGAGAAGACCATGATAAGAGGAGGCATCTTGCACATAAATTCTGTCTCACTCCAGCTGGGGAGTTCAAATGGAACGGGTCTGTTCACGGGTCCAAAGTCCTTACCATCTCAACCCTGAGACTCACCATCACACAGCTAGAGAGCAACATTCCTTCATCCTTCCTTCACCCCAATTGGGCTTCACACAGGGCTAATTGGATCAAGGCCGTTCAGATGTGTAGTAAACCCAGAGAGTTTGCGTTGGCTCTCGCAATTCTGGAGTGTGCAGTTAAGCCAGTTGTGATGCTGCCAATATGGCGGGAGTCTCTAGGACATACCCGGTTACATAGGATGACATCAATTGAAAGGGAAGAAAAAGAGAAAGTTAAAAAAAAGGAGAAAAAACAAGAGGAGGAGGAGACAATGCAGCAGGCCACATGGGTAAAATACACATTTCCAGTGAAGCACCAGGTTTGGAAACAGAAAGGTGAGGAGTACCGAGTGACAGGGTACGGCGGCTGGAGCTGGATTAGCAAGACGCACGTTTACAGATTTCTTCCCAAGTTACCAGGAAACACGAATGTAAACTACAGAAAGCCCTTGGATGGAGCCAAAAACAATACAGATGAAAATAAAGATGAGTCAGAGAAAAGGAAAAGTCCACGAAGTCCAAAAAAAATGAAGACAGAATGTGATTCTGAACAAGGTGAGACCAGAGATGCAGATGCCACAGCTGGAGCCGCCGCAGGGGCAATGGAGCTGTCTAAGGAACCTGAGAAGAAGGATCAAGATGTAAAAGAACTTTTAGATTCTGATAATGACAAATCCTTCAAGGAAGAACCAATGGAGATCGATGATACCATAAAAACAGAGTCACACGTGAGCAGTCTGGAAAGCACAGAGGTAGATGTAGTCAATGTTAGTGAGGGCTTCCATCTAAGGACTAGTTACAAAAAGAAAACGAAATCCTCTAAGCTGGACGGGCTTCTGGAACGGAGGATTCGACAATTTACACTGGAAGAAAAACAGCGTCTTGAGAAGTTAAAGCTGGAGAGTGGGGTGAAGGGGGCGGGGAAGCCCCCCATGGGTGCTCTGAAAAGCTCCTCTGAGTCTCCAGGCTCCACAAAAGCAAGCGAAGGGCATCAGGGTGACTCGCTGAGACAGGAACAAAGCCCCAGTTCAAGTCAGGCTAGCACTGTGGACTTGGGGCTGGGGGGCTCACAAAGTGATCCCTTGGTTCTTGGCATCAGTCCTCCTAGTCTAAGCACGCACAAACCTGATCCAAAAGATCAAGTATTAGATGATGTCTCCATTCAGAGTCCAGGGCCAAACTGTCAGAGGCAAAACTCAGTTGAAAGCGACCTAGATGCCAGGATCTCTGAACCTGCCGGTAAGGGACTGGAACTAAGTCAGACTAAAACAGAAGTGACTGACTCTTCCTCTGATGACTCTAAACCAACCAGTGCAGACGATGTTGGCATTTTGATCTGTAAGAGCAGAAAGCTGCACTCACAGGACGATAGCAGCACCGTTGTGTCTTCTTCCAAGAGTACTTTACCTGCATCAGTACCTAAAAGTCCCCGTGACAGAGATGCCCGGGCCTTCTCAAAAGCAGTGGACTTCGATGGGAGACTAGGTGGTGACTCTGAATATAGTAGCACTTTGGAAAATAGCTCTGATAATATGTGTATTCGGGACAGTGCTGAAGAAGATATGGTTGTTCAGAACAGCAGTGAAGCCACCTCGAAACGGTTCATAGCTCCAGAACAAGGAGGAGAAAGCGTGGAGTCGACAAAATGTCAGGTAGTTTCTAAGTCCACTGAAAACTGTGAAGACAAACTACAGGGTAAGGTAACTGAAGCAAACGGTAAGAAACTGGGCCAACATCCTCCAAAGCCAGAGGAGAGAGCAGTTAACAGATGTACTGACCAAGTCAGCCTGCGACACAGCGTTGACAGAAAGAACAGTGAACCTCGAGAGTCTGAAAAGAAAGGACAGAAAGCAAATAAATTTCAAATAAACGGCAAAGATAGCAAAGCTAAGGGGTACCTGAAGGGGCCGGGCACGAAGGACGGCTCTGATGGTAAAGTTGTGAGTAGTGCTGTAGAACCAAAGGTCAATAATATCAATAAAGTCATCCCTGGGAATACCAAGTCACTGGCTGGGAAGGAATCTGCTGCGAAGCCGTTCATCAACGGTGACATCATTATGGAAGAGTTGAGTGAACAAAACACTTCAGAAACCAACTCATACTCACTGAGTTCTTCAGATGCCAAAGGTAATCACCAAGATGGCCTCCATACCCTACCATCCACCAAAGAGTCTGCCAGTACCCAGGTAATCACACCCCGAGCCCCTTGTCCAGATCGGAACTCACTTAGTCAGGTAGAAGATATGGAAACTGAAAGTCCAGAGGTTAAGAGAGTTATCCCGTCTCCTGTTAGAACTGGAGAGGGCTCTAACCTTAGCAAGGGCTTCATGGATGACAATGGACTGCCTTCCAGCAAAGACGAGAACGTCAATGGAGAATCCCAAAGAAAGACGGTCATCACAGAAGTCACCACAATGACATCTACTGTTGCCACAGAATCAAAAACTGTCATTAAGGTAGCAAAAGGAGACAAGCAAACTGTGGTTTCTTCCACAGAAAATTGTGCCAGATCCACAGTCACAACTACCACTACCACTGTGACAAAGCTCTCCACACCCTCCCCAGACACCGGTGTGGATACCATCTCTGTAAAGGAGCAGAGTAAAACCGTGGTCACCACGACAGTGACGGACTCCTTGACCACTGCAGGAAGCACACTGGTGACATCTATGACCGTGAGCAAAGAGTACTCCACGAGAGACAGGGTAAAGCTGATGAAGTTCTCACGACCCAAGAAGACCCGCTCAGGCACTGCCCTGCCGTCCTATAGGAAGTTCGTTACCAAGAGCAGCAAAAAGAGCATATTTGTGTTACCTAATGATGACTTGAAAAAGCTGGCCAGGAAAGGAGGGATCCGGGAGGTCCCTTACTTTAATTATAACGCGAAACCTGCCTTGGATATATGGCCATACCCTTCTCCTAGACCGACCTTTGGTATCACATGGAGGTGA

Peptide sequence:

MKGNINNYFKLGQEGKYRVYHNQYSTNSFALNKHQHREDHDKRRHLAHKFCLTPAGEFKWNGSVHGSKVLTISTLRLTITQLESNIPSSFLHPNWASHRANWIKAVQMCSKPREFALALAILECAVKPVVMLPIWRESLGHTRLHRMTSIEREEKEKVKKKEKKQEEEETMQQATWVKYTFPVKHQVWKQKGEEYRVTGYGGWSWISKTHVYRFLPKLPGNTNVNYRKPLDGAKNNTDENKDESEKRKSPRSPKKMKTECDSEQGETRDADATAGAAAGAMELSKEPEKKDQDVKELLDSDNDKSFKEEPMEIDDTIKTESHVSSLESTEVDVVNVSEGFHLRTSYKKKTKSSKLDGLLERRIRQFTLEEKQRLEKLKLESGVKGAGKPPMGALKSSSESPGSTKASEGHQGDSLRQEQSPSSSQASTVDLGLGGSQSDPLVLGISPPSLSTHKPDPKDQVLDDVSIQSPGPNCQRQNSVESDLDARISEPAGKGLELSQTKTEVTDSSSDDSKPTSADDVGILICKSRKLHSQDDSSTVVSSSKSTLPASVPKSPRDRDARAFSKAVDFDGRLGGDSEYSSTLENSSDNMCIRDSAEEDMVVQNSSEATSKRFIAPEQGGESVESTKCQVVSKSTENCEDKLQGKVTEANGKKLGQHPPKPEERAVNRCTDQVSLRHSVDRKNSEPRESEKKGQKANKFQINGKDSKAKGYLKGPGTKDGSDGKVVSSAVEPKVNNINKVIPGNTKSLAGKESAAKPFINGDIIMEELSEQNTSETNSYSLSSSDAKGNHQDGLHTLPSTKESASTQVITPRAPCPDRNSLSQVEDMETESPEVKRVIPSPVRTGEGSNLSKGFMDDNGLPSSKDENVNGESQRKTVITEVTTMTSTVATESKTVIKVAKGDKQTVVSSTENCARSTVTTTTTTVTKLSTPSPDTGVDTISVKEQSKTVVTTTVTDSLTTAGSTLVTSMTVSKEYSTRDRVKLMKFSRPKKTRSGTALPSYRKFVTKSSKKSIFVLPNDDLKKLARKGGIREVPYFNYNAKPALDIWPYPSPRPTFGITWR

IRESfinder result

IRESfinder score

0.47194888

IRES/non IRES

non-IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page