top of page

mmu_circBaz2b_3151

Basic information of circular RNA
PanCircBase ID:

mmu_circBaz2b_3151

mm39_Chr. Position ID:

chr2|59752486|59807896|-

Gene name:

Baz2b

Transcript:

ENSMUST00000112550.8

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

18

Exon/intron indexes:

22,21,20,19,18,17,16,15,14,13,12,11,10,9,8,7,6,5

Exon/intron offsets:

0,1398,2518,3877,9962,11528,13072,14543,20619,20795,25944,35487,36289,37678,39878,46484,47075,55216

Genomic length:

55410

Exon/intron sizes in nt:

7,52,15,25,51,41,66,45,00,00,00,00,00,00,00,00,00,00,00,00,00,00,000

Flanking exon/introns:

chr2:59750882-59752486|chr2:59807896-59808886

Splice length:

3151

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTATAAATGGGTCGGTTAATGGAACCAGTGCAGCATCAGTACTTGGTGTCAATGCATCTGTAGTAGCCACTCCTGCTTCAAGTTCCATGGGACAGAACCAAAGCACAAGCTCAGGTGGAGGAACCCTAAAATGTCATCAGGAACAAAACAAAAGCCAGCCTGTGGACGCCAGAGCCGACAGAATCAAAGATAAGAAACCAAGGAAGAAGGCTATGGAAAGTTCTAGCAACAGTGATAGTGACTCAGGCACATCGTCAGACACCTCGAGTGAAGGCATTAGCAGCAGTGACTCAGACGATCTGGAAGAGGAAGAGGAAGAAGATCAAAGCGTGGAGGAGAGTGAAGATGACGATTCTGACTCAGAGACTGAAGCACAACACAAAAGTAACAACCAGGTGCTATTACATGGTATTTCAGACCCAAAAACAGATGGACAGAAAGCAACTGAAAAAGCCCAGGAAAGAAGAACACACCAGCCATTACCTCCTGTGTCTGAGTCCCAGACGCACCCACCATTCCAGTCCCAGCAGAAGCAGCCTCAGGTTCTCTCACAGCAGCTTCCGTTTATTTTCCAAAGCTCTCAGGCAAAGGAGGAGTCTGTGACCAAACACACCAGTGTAATACAGTCGACGGGACTGGTGTCCAATGTGAAACCTTTGTCTTTGGTAAATCAAGCCAAAAAGGAAACTTACAGGAAACTCGTAGTTCCTTCTCCTGATGTACTTAAAGCAGGGAATAAAAATACCTCTGAAGAGTCTAGTTCTTTGACCAGTGAATTGCGATCCAAACGGGAACAATATAAGCAGACATTCCCATCACAAGGAAAGAAACAGGAGATGGGGAAGAGCCTGAAGAAGGTTATTGCAGCTTTGTCAAATACTAAAGCAACCTCTAGCTCACCAGCACATCCAAAACTACCACTAGATAACAACCACCCTAATCCATTTTTGACAAATGCACTTTTAGGGAATCACCAACCAAATGGAGTCATTCAAAGCGTCATTCAAGAAGCTCCGTTAGCACTAACTACCAAAACGAAAATGCAGAGTAAGATTAACGAAAATGTCTCAAGTAGCACCCCGTTCTCCTCACCTGTCAATCTGAGCACGAGTGGGAGGAGAGCCCCTGGCAGTCAGACTCCAGCGCTGCCCTCTGCCTCGCCCATCCTGCACAGCAGTGGGAAGGAAAAGCGGGTCAGCAATGACGCAACCCCGCTCAAAGCGCACCATCACCCCCATCCGGCGGCAGCGGCCGCGGCCTTGGTGGAACAGTTTAGAGGGACAGATTCAGACGTTCCCAGTAGTAAAGACTCTGAGGACTCAAATGAGGATGAGGAGGAAGATGATGAGGAAGAAGATGAAGAGGATGATGAAGATGATGAGTCTGATGACAGTCAATCAGAATCAGATAGTAATTCACAATCAGATTCAGAAGGCTCAGAAGACGACGAGGAGAAAGACCAGGAGGAATCAGATAGTGACACTGAAGGCGAGAAACCTGCCGTGAACCTGACCCAGACAAGCTCCTCTGCCAAAAGCCCTCCCTCCAGTCTCACAGCGCACTCAGCACCTCACCTCCACATAGGAAGCCCCCCAGGCTCTGCTCCTGCTGCCCTGTGCTCTGAGTCCCAGCCTCCTGCTTTTCTTGGCACTTCTTCTTCCACACTCACTTCAACTCCACACTCTGGTACATCCAAACGAAGAAGAGTGGCAGACGATCAGGAGCTGCGCATCCCTCTGGACTATGGCTGGCAGAGGGAGACAAGGGTGAGAAACTTTGGTGGGCGCCTTCCAGGAGAAGTTGCATATTATGCCCCGTGTGGGAAGAAGCTGAGGCAGTGCCCTGACATGGTAAAGGGAATGCAGTGGTGTCTTTTGAAAGAAGAGGATGTCATTCCTCGTATCAGGGCAATGGACGGCCGAAGAGGAAGACCACCCAATCCAGATAGACCCAGAGCAAGAGAGGAATCCAGGATGAAACGCCGGAAGGGTCGCCCTCCCAATGTTGGCAGTGCAGAATTCCTAGATAACACAGATGCAAAATTACTAAGGAAACTGCAGGCTCAAGAAATAGCCAGACAAGCAGCACAAATAAAACTTTTGAGAAAACTTCAGAAGCAGGAACAGGCACGGGTTGCCAAAGAAGCTAAAAAACAGCAAGCGATAATGGCTGCGGAAGAGAAGCGCAAACAGAAAGAACAGATGAAGATTATAAAGCAGCAGGAAAAAATTAAGAGAATACAGCAAATCAGAATGGAGAAAGAACTGAGAGCTCAGCAGATTCTCGAGGCTAAAAAGAAAAAGAAGGAAGAAGCGGCAAATGCCAAATTATTGGAGGCCGAGAAACGAACCAAGGAGAAAGAACTGAGAAGACAGCAGGCTGTCCTTCTGAAACACCAGGAACGGGAGCGAAGGCGGCAGCATGTGATGCTTATGAAAGCTATGGAAGCTCGTAAAAAAGCAGAAGAAAAAGAACGATTGAAGCAAGAGAAACGTGATGAGAAAAGATTGAATAAGGAACGCAAACTAGAGCAGCGGAGACTGGAGTTAGAAATGGCGAAGGAGCTAAAGAAACCTAAGGAAGACATGTGCTTAGCAGACCAAAAGCCCTTGCCAGAGTGGCCTCGCATCCCGGGACTTGTGCTCTCTGGAACCACATTTTCAGACTGTCTCATGGTGGTGCAGTTCTTACGAAACTTTGGTAAAGTTTTGGGCTTTGATGTGAATATTGATGTTCCAAACCTCAGTGTTCTTCAAGAGGGATTGCTAAATATAGGGGACAGCATGGGTGAAGTACAAGACTTGCTTGTGAGGCTCCTCTCAGCTGCTGTATGTGATCCAGGTCTAATTACAGGATACAAGGCAAAAACAGCTCTGGGAGAACATTTGCTGAACGTTGGTGTGAATCGAGACAATGTGTCCGAGGTTTTGCAGATTTTCATGGAGGCCCACTGTGGGCAGACTGAGCTGACTGAGAGCCTGAAGACTAAAGCTTTCCAGGCTCACACTCCAGCACAGAAAGCGTCCATCCTGGCCTTCCTCGTTAACGAGCTGGCATGCAGCAAGAGTGTGGTGAGTGAGATTGACAAGAACATTGAATACATGTCTAACTTGAGAAGAGATAAATGGATGGTGGAAGGTAAACTCCGCAA

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

GCAAGAGTGTGGTGAGTGAGA

59.93

AACTTGAAGCAGGAGTGGCT

59.52

175

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

AGCAAGAGTGTGGTGAGTGAG

59.93

AACTTGAAGCAGGAGTGGCT

59.52

176

PCR template sequence:

TGGCATGCAGCAAGAGTGTGGTGAGTGAGATTGACAAGAACATTGAATACATGTCTAACTTGAGAAGAGATAAATGGATGGTGGAAGGTAAACTCCGCAAGTATAAATGGGTCGGTTAATGGAACCAGTGCAGCATCAGTACTTGGTGTCAATGCATCTGTAGTAGCCACTCCTGCTTCAAGTTCCATGGGACAGAACCA

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

27

Interacting miRNAs (#binding sites)

mmu-miR-1199-5p(3), mmu-miR-574-5p(3), mmu-miR-211-5p(2), mmu-miR-298-5p(2), mmu-miR-136-5p(2), mmu-miR-370-3p(2), mmu-miR-484(2), mmu-miR-9-5p(1), mmu-miR-93-5p(1), mmu-let-7b-5p(1), mmu-miR-122-5p(1), mmu-miR-204-5p(1), mmu-miR-146a-5p(1), mmu-miR-216a-5p(1), mmu-miR-709(1), mmu-miR-214-3p(1), mmu-miR-541-5p(1), mmu-miR-324-3p(1), mmu-miR-342-5p(1), mmu-miR-29b-2-5p(1), mmu-miR-207(1), mmu-miR-532-5p(1), mmu-miR-452-3p(1), mmu-miR-188-3p(1), mmu-miR-697(1), mmu-miR-1904(1), mmu-miR-3061-5p(1)

siRNAs for circular RNA silencing
Junction sequence

GTAAACTCCGCAAGTATAAATGGGTC

siRNA sets

TTATACTTGCGGAGTTTAC, TTTATACTTGCGGAGTTTA, ATTTATACTTGCGGAGTTT

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCBAZ2B_3151_ORF_1

1.0021

0.22085229

0.999999997

3084

ORF sequence:

ATGGGACAGAACCAAAGCACAAGCTCAGGTGGAGGAACCCTAAAATGTCATCAGGAACAAAACAAAAGCCAGCCTGTGGACGCCAGAGCCGACAGAATCAAAGATAAGAAACCAAGGAAGAAGGCTATGGAAAGTTCTAGCAACAGTGATAGTGACTCAGGCACATCGTCAGACACCTCGAGTGAAGGCATTAGCAGCAGTGACTCAGACGATCTGGAAGAGGAAGAGGAAGAAGATCAAAGCGTGGAGGAGAGTGAAGATGACGATTCTGACTCAGAGACTGAAGCACAACACAAAAGTAACAACCAGGTGCTATTACATGGTATTTCAGACCCAAAAACAGATGGACAGAAAGCAACTGAAAAAGCCCAGGAAAGAAGAACACACCAGCCATTACCTCCTGTGTCTGAGTCCCAGACGCACCCACCATTCCAGTCCCAGCAGAAGCAGCCTCAGGTTCTCTCACAGCAGCTTCCGTTTATTTTCCAAAGCTCTCAGGCAAAGGAGGAGTCTGTGACCAAACACACCAGTGTAATACAGTCGACGGGACTGGTGTCCAATGTGAAACCTTTGTCTTTGGTAAATCAAGCCAAAAAGGAAACTTACAGGAAACTCGTAGTTCCTTCTCCTGATGTACTTAAAGCAGGGAATAAAAATACCTCTGAAGAGTCTAGTTCTTTGACCAGTGAATTGCGATCCAAACGGGAACAATATAAGCAGACATTCCCATCACAAGGAAAGAAACAGGAGATGGGGAAGAGCCTGAAGAAGGTTATTGCAGCTTTGTCAAATACTAAAGCAACCTCTAGCTCACCAGCACATCCAAAACTACCACTAGATAACAACCACCCTAATCCATTTTTGACAAATGCACTTTTAGGGAATCACCAACCAAATGGAGTCATTCAAAGCGTCATTCAAGAAGCTCCGTTAGCACTAACTACCAAAACGAAAATGCAGAGTAAGATTAACGAAAATGTCTCAAGTAGCACCCCGTTCTCCTCACCTGTCAATCTGAGCACGAGTGGGAGGAGAGCCCCTGGCAGTCAGACTCCAGCGCTGCCCTCTGCCTCGCCCATCCTGCACAGCAGTGGGAAGGAAAAGCGGGTCAGCAATGACGCAACCCCGCTCAAAGCGCACCATCACCCCCATCCGGCGGCAGCGGCCGCGGCCTTGGTGGAACAGTTTAGAGGGACAGATTCAGACGTTCCCAGTAGTAAAGACTCTGAGGACTCAAATGAGGATGAGGAGGAAGATGATGAGGAAGAAGATGAAGAGGATGATGAAGATGATGAGTCTGATGACAGTCAATCAGAATCAGATAGTAATTCACAATCAGATTCAGAAGGCTCAGAAGACGACGAGGAGAAAGACCAGGAGGAATCAGATAGTGACACTGAAGGCGAGAAACCTGCCGTGAACCTGACCCAGACAAGCTCCTCTGCCAAAAGCCCTCCCTCCAGTCTCACAGCGCACTCAGCACCTCACCTCCACATAGGAAGCCCCCCAGGCTCTGCTCCTGCTGCCCTGTGCTCTGAGTCCCAGCCTCCTGCTTTTCTTGGCACTTCTTCTTCCACACTCACTTCAACTCCACACTCTGGTACATCCAAACGAAGAAGAGTGGCAGACGATCAGGAGCTGCGCATCCCTCTGGACTATGGCTGGCAGAGGGAGACAAGGGTGAGAAACTTTGGTGGGCGCCTTCCAGGAGAAGTTGCATATTATGCCCCGTGTGGGAAGAAGCTGAGGCAGTGCCCTGACATGGTAAAGGGAATGCAGTGGTGTCTTTTGAAAGAAGAGGATGTCATTCCTCGTATCAGGGCAATGGACGGCCGAAGAGGAAGACCACCCAATCCAGATAGACCCAGAGCAAGAGAGGAATCCAGGATGAAACGCCGGAAGGGTCGCCCTCCCAATGTTGGCAGTGCAGAATTCCTAGATAACACAGATGCAAAATTACTAAGGAAACTGCAGGCTCAAGAAATAGCCAGACAAGCAGCACAAATAAAACTTTTGAGAAAACTTCAGAAGCAGGAACAGGCACGGGTTGCCAAAGAAGCTAAAAAACAGCAAGCGATAATGGCTGCGGAAGAGAAGCGCAAACAGAAAGAACAGATGAAGATTATAAAGCAGCAGGAAAAAATTAAGAGAATACAGCAAATCAGAATGGAGAAAGAACTGAGAGCTCAGCAGATTCTCGAGGCTAAAAAGAAAAAGAAGGAAGAAGCGGCAAATGCCAAATTATTGGAGGCCGAGAAACGAACCAAGGAGAAAGAACTGAGAAGACAGCAGGCTGTCCTTCTGAAACACCAGGAACGGGAGCGAAGGCGGCAGCATGTGATGCTTATGAAAGCTATGGAAGCTCGTAAAAAAGCAGAAGAAAAAGAACGATTGAAGCAAGAGAAACGTGATGAGAAAAGATTGAATAAGGAACGCAAACTAGAGCAGCGGAGACTGGAGTTAGAAATGGCGAAGGAGCTAAAGAAACCTAAGGAAGACATGTGCTTAGCAGACCAAAAGCCCTTGCCAGAGTGGCCTCGCATCCCGGGACTTGTGCTCTCTGGAACCACATTTTCAGACTGTCTCATGGTGGTGCAGTTCTTACGAAACTTTGGTAAAGTTTTGGGCTTTGATGTGAATATTGATGTTCCAAACCTCAGTGTTCTTCAAGAGGGATTGCTAAATATAGGGGACAGCATGGGTGAAGTACAAGACTTGCTTGTGAGGCTCCTCTCAGCTGCTGTATGTGATCCAGGTCTAATTACAGGATACAAGGCAAAAACAGCTCTGGGAGAACATTTGCTGAACGTTGGTGTGAATCGAGACAATGTGTCCGAGGTTTTGCAGATTTTCATGGAGGCCCACTGTGGGCAGACTGAGCTGACTGAGAGCCTGAAGACTAAAGCTTTCCAGGCTCACACTCCAGCACAGAAAGCGTCCATCCTGGCCTTCCTCGTTAACGAGCTGGCATGCAGCAAGAGTGTGGTGAGTGAGATTGACAAGAACATTGAATACATGTCTAACTTGAGAAGAGATAAATGGATGGTGGAAGGTAAACTCCGCAAGTATAAATGGGTCGGTTAA

Peptide sequence:

MGQNQSTSSGGGTLKCHQEQNKSQPVDARADRIKDKKPRKKAMESSSNSDSDSGTSSDTSSEGISSSDSDDLEEEEEEDQSVEESEDDDSDSETEAQHKSNNQVLLHGISDPKTDGQKATEKAQERRTHQPLPPVSESQTHPPFQSQQKQPQVLSQQLPFIFQSSQAKEESVTKHTSVIQSTGLVSNVKPLSLVNQAKKETYRKLVVPSPDVLKAGNKNTSEESSSLTSELRSKREQYKQTFPSQGKKQEMGKSLKKVIAALSNTKATSSSPAHPKLPLDNNHPNPFLTNALLGNHQPNGVIQSVIQEAPLALTTKTKMQSKINENVSSSTPFSSPVNLSTSGRRAPGSQTPALPSASPILHSSGKEKRVSNDATPLKAHHHPHPAAAAAALVEQFRGTDSDVPSSKDSEDSNEDEEEDDEEEDEEDDEDDESDDSQSESDSNSQSDSEGSEDDEEKDQEESDSDTEGEKPAVNLTQTSSSAKSPPSSLTAHSAPHLHIGSPPGSAPAALCSESQPPAFLGTSSSTLTSTPHSGTSKRRRVADDQELRIPLDYGWQRETRVRNFGGRLPGEVAYYAPCGKKLRQCPDMVKGMQWCLLKEEDVIPRIRAMDGRRGRPPNPDRPRAREESRMKRRKGRPPNVGSAEFLDNTDAKLLRKLQAQEIARQAAQIKLLRKLQKQEQARVAKEAKKQQAIMAAEEKRKQKEQMKIIKQQEKIKRIQQIRMEKELRAQQILEAKKKKKEEAANAKLLEAEKRTKEKELRRQQAVLLKHQERERRRQHVMLMKAMEARKKAEEKERLKQEKRDEKRLNKERKLEQRRLELEMAKELKKPKEDMCLADQKPLPEWPRIPGLVLSGTTFSDCLMVVQFLRNFGKVLGFDVNIDVPNLSVLQEGLLNIGDSMGEVQDLLVRLLSAAVCDPGLITGYKAKTALGEHLLNVGVNRDNVSEVLQIFMEAHCGQTELTESLKTKAFQAHTPAQKASILAFLVNELACSKSVVSEIDKNIEYMSNLRRDKWMVEGKLRKYKWVG

IRESfinder result

IRESfinder score

0.432183484

IRES/non IRES

non-IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page