top of page

mmu_circBabam2_519

Basic information of circular RNA
PanCircBase ID:

mmu_circBabam2_519

mm39_Chr. Position ID:

chr5|31859169|31978016|+

Gene name:

Babam2

Transcript:

ENSMUST00000201352.4

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

4

Exon/intron indexes:

2,3,4,5

Exon/intron offsets:

0,29141,83752,118652

Genomic length:

118847

Exon/intron sizes in nt:

1,52,77,95,195

Flanking exon/introns:

chr5:31855421-31859169|chr5:31978016-31988428

Splice length:

519

Other database IDs:

circAtlas: hsa-BRE_0004, CIRCpedia: HSA_CIRCpedia_150481

Human Ortholog IDs:
Mature spliced Sequence:

TGGTAACTCATAAATCAAGTTAAAATGTCTCCAGAAATTGCCTTGAACCGAATTTCTCCAATGCTCTCCCCATTCATATCAAGCGTGGTCCGAAATGGGAAGGTGGGACTGGATGCTACAAACTGTTTGAGAATTACGGACTTGAAGTCTGGCTGTACATCATTGACTCCTGGACCCAACTGTGACCGCTTCAAACTGCACATCCCGTACGCTGGGGAGACGTTAAAATGGGACATAATTTTCAATGCTCAGTACCCAGAGCTGCCTCCTGATTTCATCTTTGGAGAGGATGCTGAGTTTCTGCCAGACCCCTCTGCGCTGCACAACCTTGCCTCCTGGAACCCTTCAAACCCTGAGTGCCTGTTGCTCGTGGTGAAGGAGCTGGTGCAGCAGTACCACCAGTTCCAGTGCGGCCGCCTCCGTGAGAGCTCGCGCCTCATGTTTGAGTACCAGACGCTCCTGGAAGAGCCTCAGTATGGAGAGAACATGGAAATTTATGCTGGAAAGAAAAACAACTGG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

TCGCGCCTCATGTTTGAGTA

59.75

TGAATGGGGAGAGCATTGGAG

59.79

166

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

TCGCGCCTCATGTTTGAGTA

59.75

TGAATGGGGAGAGCATTGGA

58.7

166

PCR template sequence:

CCGTGAGAGCTCGCGCCTCATGTTTGAGTACCAGACGCTCCTGGAAGAGCCTCAGTATGGAGAGAACATGGAAATTTATGCTGGAAAGAAAAACAACTGGTGGTAACTCATAAATCAAGTTAAAATGTCTCCAGAAATTGCCTTGAACCGAATTTCTCCAATGCTCTCCCCATTCATATCAAGCGTGGTCCGAAATGGGA

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

2

Interacting miRNAs (#binding sites)

mmu-miR-298-5p(1), mmu-miR-338-3p(1)

siRNAs for circular RNA silencing
Junction sequence

GAAAAACAACTGGTGGTAACTCATAA

siRNA sets

TATGAGTTACCACCAGTTG, ATGAGTTACCACCAGTTGT, TTATGAGTTACCACCAGTT

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCBABAM2_519_ORF_1

0.9204

0.31483307

0.793609095

501

ORF sequence:

ATGTCTCCAGAAATTGCCTTGAACCGAATTTCTCCAATGCTCTCCCCATTCATATCAAGCGTGGTCCGAAATGGGAAGGTGGGACTGGATGCTACAAACTGTTTGAGAATTACGGACTTGAAGTCTGGCTGTACATCATTGACTCCTGGACCCAACTGTGACCGCTTCAAACTGCACATCCCGTACGCTGGGGAGACGTTAAAATGGGACATAATTTTCAATGCTCAGTACCCAGAGCTGCCTCCTGATTTCATCTTTGGAGAGGATGCTGAGTTTCTGCCAGACCCCTCTGCGCTGCACAACCTTGCCTCCTGGAACCCTTCAAACCCTGAGTGCCTGTTGCTCGTGGTGAAGGAGCTGGTGCAGCAGTACCACCAGTTCCAGTGCGGCCGCCTCCGTGAGAGCTCGCGCCTCATGTTTGAGTACCAGACGCTCCTGGAAGAGCCTCAGTATGGAGAGAACATGGAAATTTATGCTGGAAAGAAAAACAACTGGTGGTAA

Peptide sequence:

MSPEIALNRISPMLSPFISSVVRNGKVGLDATNCLRITDLKSGCTSLTPGPNCDRFKLHIPYAGETLKWDIIFNAQYPELPPDFIFGEDAEFLPDPSALHNLASWNPSNPECLLLVVKELVQQYHQFQCGRLRESSRLMFEYQTLLEEPQYGENMEIYAGKKNNWW

IRESfinder result

IRESfinder score

0.665653694

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page