top of page

mmu_circAscc3_1538

Basic information of circular RNA
PanCircBase ID:

mmu_circAscc3_1538

mm39_Chr. Position ID:

chr10|50625130|50725742|+

Gene name:

Ascc3

Transcript:

ENSMUST00000035606.10

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

10

Exon/intron indexes:

32,33,34,35,36,37,38,39,40,41

Exon/intron offsets:

0,1418,4962,18056,18338,74601,91263,93108,96496,100436

Genomic length:

100612

Exon/intron sizes in nt:

1,21,13,31,26,11,21,35,00,00,00,00,00,00,000

Flanking exon/introns:

chr10:50625039-50625130|chr10:50725742-50726556

Splice length:

1538

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTTCTCATTGCTACAAGCACATTAGCATGGGGTGTAAACTTTCCAGCACACTTAGTAATTATTAAGGGAACTGAATATTATGATGGAAAGACAAGACGTTATGTGGATTTTCCCATCACAGATGTGCTGCAGATGATGGGACGAGCTGGGAGACCTCAGTTTGATGACCAGGGCAAAGCTGTAATTCTAGTTCATGATATAAAAAAAGATTTTTATAAAAAGTTTCTTTATGAACCTTTCCCAGTAGAATCAAGCTTATTAGGAGTGTTGTCTGACCACTTAAATGCAGAGATTGCTGGAGGTACAATAACATCAAAGCAAGATGCAATGGATTATATCACCTGGACTTACTTTTTCCGGCGTCTTATCATGAATCCCAGCTACTACAGCTTGGGTGACGTCAGCCAGGACTCCATAAACAAGTTCCTGTCACATCTGATTGGGCAGTCTCTGGTTGAATTGGAGCTTTCCCACTGCATTGAAGTTGGAGAGGATAATCGCACCATTGAACCACTGACATGTGGTCGAATTGCCTCCTATTACTATTTGAAGCACAAAACTGTCAAAATGTTCAAGGACCGTTTGAAACCTGAGTGCAGCACTGAGGAACTGCTGTCAATTCTGAGTGATGCAGAAGAATACACAGACTTACCAGTAAGACACAATGAGGACCATACGAATAATGAATTGGCCAAATGTCTTCCCATTGAATTAAATCCTCATTCATTTGACAGCCCTCACACCAAAGCCCATCTCTTGCTTCAAGCGCATCTCAGCCGAGCCATGCTGCCCTGCCCAGATTATGATACTGATACCAAAACAGTCTTAGACCAAGCTCTCAGAGTATGCCAGGCAATGCTGGATGTGGCTGCAAGCCAGGGATGGCTAGTGACCGTCCTGAATATCACCCACCTGATTCAGATGGTGATCCAAGGCCGATGGCTCAAGGACTCTTCTCTTCTCACAATACCAAACATAGAGCAGCACCACCTTCACCTTTTCAGGAAATGGAAGCCACCTGTAAAGAGCTCACATGCTAAGTGCCGAACATCCATTGAGTGCCTTCCTGAGCTGATCCATGCCTGTGAAGGGAAGGACCATGTGTTCAGCTCCATGGTAGAGAAAGAGTTACAGCCTGCAAAAACAAAGCAGGCATGGAATTTCTTATCTCGCTTGCCAGTGATAAATGTTGGCATAAGTGTTAAAGGCTCATGGGATGACTTAGTTGAAGGACATAATGAACTCTCCATCTCAACTCTGACAGCAGACAAACGGGATGAAAACAAATGGATCAAGTTGCATGCTGATCAGGAGTATGTGCTTCAAGTCAGCCTACAGAGAGTCCATTTTGGGCTTCCAAAGGGAAAACATGAGAATCACGCAGTTACTCCTCGATTTCCAAAATTAAAAGATGAAGGCTGGTTTTTGATATTAGGAGAAGTGGATAAGAGAGAGCTGATGGCTGTAAAACGAGTAGGATTTGTTCGAACACATCATGATGCTTCCATCTCGTTCTTTACTCCTGAAACACCTGGAAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

TGGATAAGAGAGAGCTGATGGC

59.37

TGCTGGAAAGTTTACACCCCA

59.78

145

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

TGGATAAGAGAGAGCTGATGGC

59.37

GTGCTGGAAAGTTTACACCCC

59.39

146

PCR template sequence:

AAGTGGATAAGAGAGAGCTGATGGCTGTAAAACGAGTAGGATTTGTTCGAACACATCATGATGCTTCCATCTCGTTCTTTACTCCTGAAACACCTGGAAGGTTCTCATTGCTACAAGCACATTAGCATGGGGTGTAAACTTTCCAGCACACTTAGTAATTATTAAGGGAACTGAATATTATGATGGAAAGACAAGACGTT

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

13

Interacting miRNAs (#binding sites)

mmu-miR-433-3p(2), mmu-miR-124-3p(1), mmu-miR-7b-5p(1), mmu-miR-103-3p(1), mmu-miR-211-5p(1), mmu-miR-204-5p(1), mmu-miR-7a-5p(1), mmu-miR-136-5p(1), mmu-miR-107-3p(1), mmu-miR-129-5p(1), mmu-miR-207(1), mmu-miR-540-3p(1), mmu-miR-7a-1-3p(1)

siRNAs for circular RNA silencing
Junction sequence

AAACACCTGGAAGGTTCTCATTGCTA

siRNA sets

TAGCAATGAGAACCTTCCA, GCAATGAGAACCTTCCAGG

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCASCC3_1538_ORF_1

0.8868

0.097736183

0.999142216

1431

ORF sequence:

ATGATGGGACGAGCTGGGAGACCTCAGTTTGATGACCAGGGCAAAGCTGTAATTCTAGTTCATGATATAAAAAAAGATTTTTATAAAAAGTTTCTTTATGAACCTTTCCCAGTAGAATCAAGCTTATTAGGAGTGTTGTCTGACCACTTAAATGCAGAGATTGCTGGAGGTACAATAACATCAAAGCAAGATGCAATGGATTATATCACCTGGACTTACTTTTTCCGGCGTCTTATCATGAATCCCAGCTACTACAGCTTGGGTGACGTCAGCCAGGACTCCATAAACAAGTTCCTGTCACATCTGATTGGGCAGTCTCTGGTTGAATTGGAGCTTTCCCACTGCATTGAAGTTGGAGAGGATAATCGCACCATTGAACCACTGACATGTGGTCGAATTGCCTCCTATTACTATTTGAAGCACAAAACTGTCAAAATGTTCAAGGACCGTTTGAAACCTGAGTGCAGCACTGAGGAACTGCTGTCAATTCTGAGTGATGCAGAAGAATACACAGACTTACCAGTAAGACACAATGAGGACCATACGAATAATGAATTGGCCAAATGTCTTCCCATTGAATTAAATCCTCATTCATTTGACAGCCCTCACACCAAAGCCCATCTCTTGCTTCAAGCGCATCTCAGCCGAGCCATGCTGCCCTGCCCAGATTATGATACTGATACCAAAACAGTCTTAGACCAAGCTCTCAGAGTATGCCAGGCAATGCTGGATGTGGCTGCAAGCCAGGGATGGCTAGTGACCGTCCTGAATATCACCCACCTGATTCAGATGGTGATCCAAGGCCGATGGCTCAAGGACTCTTCTCTTCTCACAATACCAAACATAGAGCAGCACCACCTTCACCTTTTCAGGAAATGGAAGCCACCTGTAAAGAGCTCACATGCTAAGTGCCGAACATCCATTGAGTGCCTTCCTGAGCTGATCCATGCCTGTGAAGGGAAGGACCATGTGTTCAGCTCCATGGTAGAGAAAGAGTTACAGCCTGCAAAAACAAAGCAGGCATGGAATTTCTTATCTCGCTTGCCAGTGATAAATGTTGGCATAAGTGTTAAAGGCTCATGGGATGACTTAGTTGAAGGACATAATGAACTCTCCATCTCAACTCTGACAGCAGACAAACGGGATGAAAACAAATGGATCAAGTTGCATGCTGATCAGGAGTATGTGCTTCAAGTCAGCCTACAGAGAGTCCATTTTGGGCTTCCAAAGGGAAAACATGAGAATCACGCAGTTACTCCTCGATTTCCAAAATTAAAAGATGAAGGCTGGTTTTTGATATTAGGAGAAGTGGATAAGAGAGAGCTGATGGCTGTAAAACGAGTAGGATTTGTTCGAACACATCATGATGCTTCCATCTCGTTCTTTACTCCTGAAACACCTGGAAGGTTCTCATTGCTACAAGCACATTAG

Peptide sequence:

MMGRAGRPQFDDQGKAVILVHDIKKDFYKKFLYEPFPVESSLLGVLSDHLNAEIAGGTITSKQDAMDYITWTYFFRRLIMNPSYYSLGDVSQDSINKFLSHLIGQSLVELELSHCIEVGEDNRTIEPLTCGRIASYYYLKHKTVKMFKDRLKPECSTEELLSILSDAEEYTDLPVRHNEDHTNNELAKCLPIELNPHSFDSPHTKAHLLLQAHLSRAMLPCPDYDTDTKTVLDQALRVCQAMLDVAASQGWLVTVLNITHLIQMVIQGRWLKDSSLLTIPNIEQHHLHLFRKWKPPVKSSHAKCRTSIECLPELIHACEGKDHVFSSMVEKELQPAKTKQAWNFLSRLPVINVGISVKGSWDDLVEGHNELSISTLTADKRDENKWIKLHADQEYVLQVSLQRVHFGLPKGKHENHAVTPRFPKLKDEGWFLILGEVDKRELMAVKRVGFVRTHHDASISFFTPETPGRFSLLQAH

IRESfinder result

IRESfinder score

0.594444018

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page