top of page

mmu_circApi5_1209

Basic information of circular RNA
PanCircBase ID:

mmu_circApi5_1209

mm39_Chr. Position ID:

chr2|94251330|94260185|-

Gene name:

Api5

Transcript:

ENSMUST00000028617.7

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

10

Exon/intron indexes:

11,10,9,8,7,6,5,4,3,2

Exon/intron offsets:

0,447,1311,2426,3988,4605,5947,6526,7060,8693

Genomic length:

8855

Exon/intron sizes in nt:

57,94,18,29,01,05,20,70,00,00,00,000

Flanking exon/introns:

chr2:94249292-94251330|chr2:94260185-94268268

Splice length:

1209

Other database IDs:

circAtlas: mmu-Api5_0002

circAtlas: hsa-SCAF8_0001, CIRCpedia: HSA_CIRCpedia_167031

Human Ortholog IDs:
Mature spliced Sequence:

CATAAAGATGCCTACCAAGTGATACTGGATGGCGTGAAAGGCGGCACCAAGGAAAAGCGATTAGCAGCTCAGTTTATACCAAAATTCTTTAAGCATTTTCCAGAGCTGGCTGATTCTGCTATCAATGCACAGTTAGACCTCTGTGAGGATGAAGATGTGTCAATACGACGTCAAGCAATTAAAGAGCTGCCTCAGTTTGCCACAGGAGAAAACCTTCCTAGAGTAGCAGATATACTGACCCAGCTTCTGCAGACAGATGACTCTGCAGAATTTAACCTGGTGAACAATGCTCTGCTAAGTATATTTAAGATGGATGCAAAAGGAACGTTAGGTGGCTTGTTTAGCCAGATTCTTCAAGGAGAAGACATTGTTAGAGAACGAGCAATTAAATTCCTGTCCACAAAACTCAAGACGCTCCCAGATGAGGTGTTGACTAAGGAAGTGGAGGAACTCATACTCACTGAGTCCAAGAAGGTCCTAGAAGACGTGACTGGTGAAGAGTTTGTTTTGTTCATGAAGATACTGTCTGGGTTGAAAAGCTTACAGACAGTGAGTGGACGACAGCAGCTGGTGGAGCTGGTGGCGGAACAGGCTGACCTGGAGCAGGCCTTCAGCCCCTCAGACCCCGACTGTGTGGACAGACTACTGCAGTGCACGCGGCAGGCTGTGCCTCTCTTCTCCAAAAATGTGCATTCTACAAGATTTGTGACGTATTTCTGTGAGCAAGTTCTCCCTAACCTCAGCACCCTGACCACCCCAGTGGAAGGCCTCGATATACAGCTGGAGGTATTAAAGTTGTTGGCAGAGATGAGTTCATTTTGTGGTGACATGGAAAAACTAGAAACAAATTTAAGAAAACTGTTTGATAAGTTATTGGAGTATATGCCTCTCCCTCCAGAAGAAGCAGAAAATGGGGAGAATGCTGGTAATGAGGAGCCCAAGCTGCAGTTCAGTTATGTGGAGTGCTTATTGTACAGTTTTCATCAGTTGGGGCGAAAACTTCCAGACTTCTTAACAGCCAAACTGAATGCAGAAAAACTCAAGGATTTCAAAATTAGGTTGCAGTACTTTGCACGGGGCCTGCAGGTTTATATCAGACAACTTCGCTTGGCTCTCCAGGGTAAAACAGGCGAGGCCTTAAAAACAGAGGAGAACAAGATAAAAGTTGTTGCACTGAAAATAACAAACAATATCAATGTTTTAATCAAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

TCCAGGGTAAAACAGGCGAG

59.68

AATCGCTTTTCCTTGGTGCC

59.4

157

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

CTCCAGGGTAAAACAGGCGA

59.68

AATCGCTTTTCCTTGGTGCC

59.4

158

PCR template sequence:

GGCTCTCCAGGGTAAAACAGGCGAGGCCTTAAAAACAGAGGAGAACAAGATAAAAGTTGTTGCACTGAAAATAACAAACAATATCAATGTTTTAATCAAGCATAAAGATGCCTACCAAGTGATACTGGATGGCGTGAAAGGCGGCACCAAGGAAAAGCGATTAGCAGCTCAGTTTATACCAAAATTCTTTAAGCATTTTC

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

12

Interacting miRNAs (#binding sites)

mmu-miR-1904(2), mmu-miR-19b-3p(1), mmu-miR-33-5p(1), mmu-miR-19a-3p(1), mmu-miR-148b-3p(1), mmu-miR-148a-3p(1), mmu-miR-199b-3p(1), mmu-miR-301b-3p(1), mmu-miR-199a-3p(1), mmu-miR-382-5p(1), mmu-miR-301a-3p(1), mmu-miR-5101(1)

siRNAs for circular RNA silencing
Junction sequence

TGTTTTAATCAAGCATAAAGATGCCT

siRNA sets

TTTATGCTTGATTAAAACA, CTTTATGCTTGATTAAAAC

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCAPI5_1209_ORF_1

1.0626

0.20251363

0.99999702

2109

ORF sequence:

ATGGATGCAAAAGGAACGTTAGGTGGCTTGTTTAGCCAGATTCTTCAAGGAGAAGACATTGTTAGAGAACGAGCAATTAAATTCCTGTCCACAAAACTCAAGACGCTCCCAGATGAGGTGTTGACTAAGGAAGTGGAGGAACTCATACTCACTGAGTCCAAGAAGGTCCTAGAAGACGTGACTGGTGAAGAGTTTGTTTTGTTCATGAAGATACTGTCTGGGTTGAAAAGCTTACAGACAGTGAGTGGACGACAGCAGCTGGTGGAGCTGGTGGCGGAACAGGCTGACCTGGAGCAGGCCTTCAGCCCCTCAGACCCCGACTGTGTGGACAGACTACTGCAGTGCACGCGGCAGGCTGTGCCTCTCTTCTCCAAAAATGTGCATTCTACAAGATTTGTGACGTATTTCTGTGAGCAAGTTCTCCCTAACCTCAGCACCCTGACCACCCCAGTGGAAGGCCTCGATATACAGCTGGAGGTATTAAAGTTGTTGGCAGAGATGAGTTCATTTTGTGGTGACATGGAAAAACTAGAAACAAATTTAAGAAAACTGTTTGATAAGTTATTGGAGTATATGCCTCTCCCTCCAGAAGAAGCAGAAAATGGGGAGAATGCTGGTAATGAGGAGCCCAAGCTGCAGTTCAGTTATGTGGAGTGCTTATTGTACAGTTTTCATCAGTTGGGGCGAAAACTTCCAGACTTCTTAACAGCCAAACTGAATGCAGAAAAACTCAAGGATTTCAAAATTAGGTTGCAGTACTTTGCACGGGGCCTGCAGGTTTATATCAGACAACTTCGCTTGGCTCTCCAGGGTAAAACAGGCGAGGCCTTAAAAACAGAGGAGAACAAGATAAAAGTTGTTGCACTGAAAATAACAAACAATATCAATGTTTTAATCAAGCATAAAGATGCCTACCAAGTGATACTGGATGGCGTGAAAGGCGGCACCAAGGAAAAGCGATTAGCAGCTCAGTTTATACCAAAATTCTTTAAGCATTTTCCAGAGCTGGCTGATTCTGCTATCAATGCACAGTTAGACCTCTGTGAGGATGAAGATGTGTCAATACGACGTCAAGCAATTAAAGAGCTGCCTCAGTTTGCCACAGGAGAAAACCTTCCTAGAGTAGCAGATATACTGACCCAGCTTCTGCAGACAGATGACTCTGCAGAATTTAACCTGGTGAACAATGCTCTGCTAAGTATATTTAAGATGGATGCAAAAGGAACGTTAGGTGGCTTGTTTAGCCAGATTCTTCAAGGAGAAGACATTGTTAGAGAACGAGCAATTAAATTCCTGTCCACAAAACTCAAGACGCTCCCAGATGAGGTGTTGACTAAGGAAGTGGAGGAACTCATACTCACTGAGTCCAAGAAGGTCCTAGAAGACGTGACTGGTGAAGAGTTTGTTTTGTTCATGAAGATACTGTCTGGGTTGAAAAGCTTACAGACAGTGAGTGGACGACAGCAGCTGGTGGAGCTGGTGGCGGAACAGGCTGACCTGGAGCAGGCCTTCAGCCCCTCAGACCCCGACTGTGTGGACAGACTACTGCAGTGCACGCGGCAGGCTGTGCCTCTCTTCTCCAAAAATGTGCATTCTACAAGATTTGTGACGTATTTCTGTGAGCAAGTTCTCCCTAACCTCAGCACCCTGACCACCCCAGTGGAAGGCCTCGATATACAGCTGGAGGTATTAAAGTTGTTGGCAGAGATGAGTTCATTTTGTGGTGACATGGAAAAACTAGAAACAAATTTAAGAAAACTGTTTGATAAGTTATTGGAGTATATGCCTCTCCCTCCAGAAGAAGCAGAAAATGGGGAGAATGCTGGTAATGAGGAGCCCAAGCTGCAGTTCAGTTATGTGGAGTGCTTATTGTACAGTTTTCATCAGTTGGGGCGAAAACTTCCAGACTTCTTAACAGCCAAACTGAATGCAGAAAAACTCAAGGATTTCAAAATTAGGTTGCAGTACTTTGCACGGGGCCTGCAGGTTTATATCAGACAACTTCGCTTGGCTCTCCAGGGTAAAACAGGCGAGGCCTTAAAAACAGAGGAGAACAAGATAAAAGTTGTTGCACTGAAAATAACAAACAATATCAATGTTTTAATCAAG

Peptide sequence:

MDAKGTLGGLFSQILQGEDIVRERAIKFLSTKLKTLPDEVLTKEVEELILTESKKVLEDVTGEEFVLFMKILSGLKSLQTVSGRQQLVELVAEQADLEQAFSPSDPDCVDRLLQCTRQAVPLFSKNVHSTRFVTYFCEQVLPNLSTLTTPVEGLDIQLEVLKLLAEMSSFCGDMEKLETNLRKLFDKLLEYMPLPPEEAENGENAGNEEPKLQFSYVECLLYSFHQLGRKLPDFLTAKLNAEKLKDFKIRLQYFARGLQVYIRQLRLALQGKTGEALKTEENKIKVVALKITNNINVLIKHKDAYQVILDGVKGGTKEKRLAAQFIPKFFKHFPELADSAINAQLDLCEDEDVSIRRQAIKELPQFATGENLPRVADILTQLLQTDDSAEFNLVNNALLSIFKMDAKGTLGGLFSQILQGEDIVRERAIKFLSTKLKTLPDEVLTKEVEELILTESKKVLEDVTGEEFVLFMKILSGLKSLQTVSGRQQLVELVAEQADLEQAFSPSDPDCVDRLLQCTRQAVPLFSKNVHSTRFVTYFCEQVLPNLSTLTTPVEGLDIQLEVLKLLAEMSSFCGDMEKLETNLRKLFDKLLEYMPLPPEEAENGENAGNEEPKLQFSYVECLLYSFHQLGRKLPDFLTAKLNAEKLKDFKIRLQYFARGLQVYIRQLRLALQGKTGEALKTEENKIKVVALKITNNINVLIK

IRESfinder result

IRESfinder score

0.612511636

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page