top of page

mmu_circAfdn_3660

Basic information of circular RNA
PanCircBase ID:

mmu_circAfdn_3660

mm39_Chr. Position ID:

chr17|14024200|14105769|+

Gene name:

Afdn

Transcript:

ENSMUST00000170827.9

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

27

Exon/intron indexes:

2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28

Exon/intron offsets:

0,3341,4993,6471,14182,18327,19352,24990,25931,28429,31299,42333,42495,45169,45629,46841,48377,51275,55934,57787,57836,77346,77912,78444,79802,80630,81383

Genomic length:

81569

Exon/intron sizes in nt:

196,113,164,161,158,112,168,95,263,70,119,62,206,146,95,266,144,199,108,2,81,66,74,119,195,92,186

Flanking exon/introns:

chr17:13981040-14024200|chr17:14105769-14108243

Splice length:

3660

Other database IDs:

circAtlas: mmu-Mllt4_0008

Human Ortholog IDs:
Mature spliced Sequence:

GATTTGGAGTTTCATGGAGTCATGAGATTTTATTTTCAAGATAAAGCTGCTGGAAACTTTGCAACAAAATGTATTCGAGTCTCTAGCACAGCCACCACTCAAGATGTGATTGAAACACTGGCAGAGAAGTTCCGCCCTGACATGCGCATGCTCTCCTCTCCCAAGTACTCCCTCTATGAAGTGCATGTCAGTGGAGAAAGAAGATTGGACATTGATGAGAAACCTCTAGTTGTACAGTTGAATTGGAACAAAGATGATCGAGAGGGTCGATTCGTCCTTAAGAACGAGAATGACGCCATTCCTGCCAAGAAGGCTCAGAGTAATGGACCTGAAAAGCAGGAGAAAGAAGGTGTTATTCAGAACTTCAAAAGAACTCTCTCAAAGAAAGAAAAGAAGGAAAAAAAGAAGAAAGAGAAGGAGGCATTGAGACAAGCCTCTGATAAGGAAGAAAGGCCTTCTCAAGGGGATGACAGTGAGAACTCACGACTGGCTGCTGAAGTTTACAAAGACATGCCTGAGACCAGCTTTACTAGGACCATTTCTAACCCTGAAGTTGTCATGAAACGGCGGCGGCAGCAAAAACTGGAGAAGAGAATGCAAGAGTTTCGGAGCTCAGATGGGCGGCCTGACTCAGGTGGAACACTGAGGATATATGCAGATAGTTTAAAACCAAATATTCCATACAAGACAATCCTGCTGTCTACTACCGATACCGCAGACTTTGCTGTAGCCGAATCTTTGGAGAAGTATGGTCTGGAAAAAGAGAATCCCAAGGACTACTGTATTGCCCGGGTTATGCTTCCTCCTGGAGCCCAGCATTCTGATGAGAGAGGTGCTAAGGAAATAATTCTTGACGATGATGAATGTCCTTTACAAATCTTCAGGGAATGGCCAAGTGACAAAGGGATTTTAGTCTTTCAGTTGAAGAGGAGACCACCGGACTACATCCCAAAGAAAATGAAGAAACATGTTGAAGGGAAGTCGTTGAAGGGGAAAGACAGAGCTGACGGGTCTGGCTACGGCTCCGCTCTTCCTCCCGAGAAGCTGCCCTACTTAGTAGAGCTAAGCCCAGATGGCTCTGACTCCAGAGACAAGCCAAAGTTATACCGCCTTCAATTAAGTGTGACTGAAGTTGGGACAGAGAAATTTGATGACAATTCTATCCAGCTGTTTGGCCCCGGAATTCAGCCCCATCACTGTGATCTCACCAACATGGATGGAGTGGTCACTGTGACACCCAGAAGTATGGATGCAGAGACCTACGTGGATGGTCAGCGCATCTCAGAGACCACAATGCTGCAGAGTGGCATGAGACTGCAGTTTGGCACCTCGCATGTGTTTAAGTTTGTGGACCCCATCCAGGACCACGTTCTTTCCAAGAGATCTGTGGATGGAGGCCTGATGGTCAAGGGCCCAAGACATAAACCTGGAGCTGTTCAGGAGACAACCTTTGAATTGGGAGGAGATGTCCACAGTGGGACAGCATTGCCGGCAAGCAGGAGCACTACTAGACTGGACAGTGACAGGGTGTCCTCTGCCTCTAGCACAGCTGAGCGAGGGATGGTGAAGCCGATGATCCGACTGGACCAGGAGCAGGAATATCGACGACGAGAAAACAGGACTCAGGATGCTACTGGGCCTGAACTGATACTGCCTGCCAGCATTGAATTCAGGGAAAGCTCTGAAGACTCTTTTTTATCTGCCATTATAAACTATACCAATAGTTCTACAGTTCATTTTAAGTTGTCACCTACATATGTGTTATACATGGCATGCCGGTATGTATTGTCCAGCCAGCACAGGCCCGACATCAGTCCTACAGAGCGTACACATAAGGCCATTGCTGTTGTCAACAAGATGGTGAGCATGATGGAAGGGGTCATCCAGAAACAGAAGAACATTGCAGGAGCACTTGCTTTTTGGATGGCAAATGCATCTGAGCTTCTCAACTTCATCAAGCAGGACCGAGACCTTAGTCGGATCACGCTGGATGCCCAGGATGTCCTAGCACACTTGGTTCAGATGGCATTTAAGTACTTGGTTCATTGCCTTCAGTCAGAACTTAATAACTACATGCCAGCCTTTCTGGATGATCCTGAGGAGAACAGTCTGCAAAGACCAAAAATAGATGATGTGCTGCACACACTCACAGGAGCCATGTCCTTGCTGCGGCGCTGCAGAGTCAATGCTGCCTTGACCATCCAGCTCTTCTCTCAGCTTTTCCACTTCATCAATATGTGGCTGTTCAACAGACTGGTGACTGACCCAGATTCAGGCCTGTGCTCCCACTACTGGGGTGCCATTATCCGCCAGCAGCTGGGGCATATTGAAGCGTGGGCAGAGAAGCAGGGGCTAGAGCTGGCAGCTGACTGTCACTTGAGCAGAATTGTACAGGCTACAACATTGCTTACGATGGATAAGTATGTACCTGATGACATTCCAAATATAAACAGCACATGCTTTAAGTTAAATTCTCTGCAGCTTCAAGCCTTGTTACAAAATTACCACTGTGCACCCGATGAGCCTTTTATTCCTACGGATCTCATAGAAAATGTTGTGGCTGTTGCTGAGAACACAGCTGATGAGCTCGCCCGCAGTGATGGCAGAGACGTGCAGCTGGAGGAAGACCCAGACCTACAGCTGCCTTTTCTTCTGCCAGAAGATGGCTATTCCTGTGATGTTGTCAGAAACATTCCAAATGGTTTACAAGAATTTTTAGACCCTCTGTGCCAGAGAGGATTTTGTAGATTGGTTCCTCACACACGTTCACCAGGTACCTGGACAATATATTTTGAAGGAGCAGATTATGAAAGTCACCTTATGCGTGAGAACGCAGAACTGGCAACACCTCTGAGGAAGGAGCCTGAGATAATCACTGTGACTCTGAAGAAGCAGAATGGAATGGGCCTCAGCATCGTTGCAGCCAAGGGTGCTGGCCAGGATAAACTGGGAATCTACGTTAAGTCGGTTGTCAAAGGAGGTGCTGCAGATGTGGATGGACGATTAGCTGCTGGTGACCAACTCCTCAGTGTGGATGGACGAAGTCTGGTTGGACTTTCTCAGGAAAGGGCAGCAGAACTCATGACAAGAACCAGTTCCGTGGTTACACTGGAAGTTGCAAAGCAAGGTGCCATCTATCACGGCCTGGCCACCCTCCTTAACCAGCCGTCCCCCATGATGCAAAGAATTTCAGATCGTCGTGGCTCAGGTAAACCCAGACCAAAGAGTGAAGGTTTTGAGCTCTATAATAATTCAGCTCAAAATGGCTCCCCAGAGAGTCCTCAGATGCCTTGGACAGAGTACAGTGAGCCAAAGAAACTGCCTGGGGATGACAGGCTGATGAAAAACAGAGCGGACCACCGTTCCAGCCCCAATGTGGCAAATCAGCCTCCTAGCCCTGGAGGGAAGGGTCCATATACATCTGGAACAGCAGCTAAGATAACATCTGTCTCCACTGGAAACCTCTGCACTGAGGAGCAGTCCCCTCCACCCAGACCTGAAGCCTATCCTATCCCTACTCAGACATACACCAGAGAGTATTTTACCTTTCCAGCTTCAAAGTCGCAGGATCGGATGGCTCCTCCTCAGAGCCAGTGGCCAAATTATGAGGAAAAACCACATGTGCACACAGAAAGTAATCATTCCAGTATTGCAATCCAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

TCCTCCTCAGAGCCAGTGG

60.31

GGTGGCTGTGCTAGAGACTC

59.83

178

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

TCCTCCTCAGAGCCAGTGG

60.31

GTGGCTGTGCTAGAGACTCG

60.18

177

PCR template sequence:

GTCGCAGGATCGGATGGCTCCTCCTCAGAGCCAGTGGCCAAATTATGAGGAAAAACCACATGTGCACACAGAAAGTAATCATTCCAGTATTGCAATCCAGGATTTGGAGTTTCATGGAGTCATGAGATTTTATTTTCAAGATAAAGCTGCTGGAAACTTTGCAACAAAATGTATTCGAGTCTCTAGCACAGCCACCACTC

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

39

Interacting miRNAs (#binding sites)

mmu-miR-27b-3p(3), mmu-miR-27a-3p(3), mmu-miR-1904(3), mmu-miR-103-3p(2), mmu-miR-320-3p(2), mmu-miR-127-5p(2), mmu-miR-107-3p(2), mmu-miR-484(2), mmu-miR-1199-5p(2), mmu-miR-670-5p(2), mmu-miR-697(2), mmu-miR-140-5p(1), mmu-miR-1a-3p(1), mmu-miR-199a-5p(1), mmu-miR-206-3p(1), mmu-miR-181a-5p(1), mmu-miR-211-5p(1), mmu-miR-204-5p(1), mmu-miR-15b-5p(1), mmu-miR-298-5p(1), mmu-miR-709(1), mmu-miR-326-3p(1), mmu-miR-181b-5p(1), mmu-miR-128-3p(1), mmu-miR-136-5p(1), mmu-miR-22-3p(1), mmu-miR-199b-3p(1), mmu-miR-199a-3p(1), mmu-miR-297a-5p(1), mmu-miR-466d-3p(1), mmu-miR-27a-5p(1), mmu-miR-680(1), mmu-miR-129-5p(1), mmu-miR-207(1), mmu-miR-335-3p(1), mmu-miR-452-3p(1), mmu-miR-3470b(1), mmu-miR-574-5p(1), mmu-miR-181d-5p(1)

siRNAs for circular RNA silencing
Junction sequence

TATTGCAATCCAGGATTTGGAGTTTC

siRNA sets

NA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCAFDN_3660_ORF_1

1.0855

0.224947899

1

7299

ORF sequence:

ATGAGATTTTATTTTCAAGATAAAGCTGCTGGAAACTTTGCAACAAAATGTATTCGAGTCTCTAGCACAGCCACCACTCAAGATGTGATTGAAACACTGGCAGAGAAGTTCCGCCCTGACATGCGCATGCTCTCCTCTCCCAAGTACTCCCTCTATGAAGTGCATGTCAGTGGAGAAAGAAGATTGGACATTGATGAGAAACCTCTAGTTGTACAGTTGAATTGGAACAAAGATGATCGAGAGGGTCGATTCGTCCTTAAGAACGAGAATGACGCCATTCCTGCCAAGAAGGCTCAGAGTAATGGACCTGAAAAGCAGGAGAAAGAAGGTGTTATTCAGAACTTCAAAAGAACTCTCTCAAAGAAAGAAAAGAAGGAAAAAAAGAAGAAAGAGAAGGAGGCATTGAGACAAGCCTCTGATAAGGAAGAAAGGCCTTCTCAAGGGGATGACAGTGAGAACTCACGACTGGCTGCTGAAGTTTACAAAGACATGCCTGAGACCAGCTTTACTAGGACCATTTCTAACCCTGAAGTTGTCATGAAACGGCGGCGGCAGCAAAAACTGGAGAAGAGAATGCAAGAGTTTCGGAGCTCAGATGGGCGGCCTGACTCAGGTGGAACACTGAGGATATATGCAGATAGTTTAAAACCAAATATTCCATACAAGACAATCCTGCTGTCTACTACCGATACCGCAGACTTTGCTGTAGCCGAATCTTTGGAGAAGTATGGTCTGGAAAAAGAGAATCCCAAGGACTACTGTATTGCCCGGGTTATGCTTCCTCCTGGAGCCCAGCATTCTGATGAGAGAGGTGCTAAGGAAATAATTCTTGACGATGATGAATGTCCTTTACAAATCTTCAGGGAATGGCCAAGTGACAAAGGGATTTTAGTCTTTCAGTTGAAGAGGAGACCACCGGACTACATCCCAAAGAAAATGAAGAAACATGTTGAAGGGAAGTCGTTGAAGGGGAAAGACAGAGCTGACGGGTCTGGCTACGGCTCCGCTCTTCCTCCCGAGAAGCTGCCCTACTTAGTAGAGCTAAGCCCAGATGGCTCTGACTCCAGAGACAAGCCAAAGTTATACCGCCTTCAATTAAGTGTGACTGAAGTTGGGACAGAGAAATTTGATGACAATTCTATCCAGCTGTTTGGCCCCGGAATTCAGCCCCATCACTGTGATCTCACCAACATGGATGGAGTGGTCACTGTGACACCCAGAAGTATGGATGCAGAGACCTACGTGGATGGTCAGCGCATCTCAGAGACCACAATGCTGCAGAGTGGCATGAGACTGCAGTTTGGCACCTCGCATGTGTTTAAGTTTGTGGACCCCATCCAGGACCACGTTCTTTCCAAGAGATCTGTGGATGGAGGCCTGATGGTCAAGGGCCCAAGACATAAACCTGGAGCTGTTCAGGAGACAACCTTTGAATTGGGAGGAGATGTCCACAGTGGGACAGCATTGCCGGCAAGCAGGAGCACTACTAGACTGGACAGTGACAGGGTGTCCTCTGCCTCTAGCACAGCTGAGCGAGGGATGGTGAAGCCGATGATCCGACTGGACCAGGAGCAGGAATATCGACGACGAGAAAACAGGACTCAGGATGCTACTGGGCCTGAACTGATACTGCCTGCCAGCATTGAATTCAGGGAAAGCTCTGAAGACTCTTTTTTATCTGCCATTATAAACTATACCAATAGTTCTACAGTTCATTTTAAGTTGTCACCTACATATGTGTTATACATGGCATGCCGGTATGTATTGTCCAGCCAGCACAGGCCCGACATCAGTCCTACAGAGCGTACACATAAGGCCATTGCTGTTGTCAACAAGATGGTGAGCATGATGGAAGGGGTCATCCAGAAACAGAAGAACATTGCAGGAGCACTTGCTTTTTGGATGGCAAATGCATCTGAGCTTCTCAACTTCATCAAGCAGGACCGAGACCTTAGTCGGATCACGCTGGATGCCCAGGATGTCCTAGCACACTTGGTTCAGATGGCATTTAAGTACTTGGTTCATTGCCTTCAGTCAGAACTTAATAACTACATGCCAGCCTTTCTGGATGATCCTGAGGAGAACAGTCTGCAAAGACCAAAAATAGATGATGTGCTGCACACACTCACAGGAGCCATGTCCTTGCTGCGGCGCTGCAGAGTCAATGCTGCCTTGACCATCCAGCTCTTCTCTCAGCTTTTCCACTTCATCAATATGTGGCTGTTCAACAGACTGGTGACTGACCCAGATTCAGGCCTGTGCTCCCACTACTGGGGTGCCATTATCCGCCAGCAGCTGGGGCATATTGAAGCGTGGGCAGAGAAGCAGGGGCTAGAGCTGGCAGCTGACTGTCACTTGAGCAGAATTGTACAGGCTACAACATTGCTTACGATGGATAAGTATGTACCTGATGACATTCCAAATATAAACAGCACATGCTTTAAGTTAAATTCTCTGCAGCTTCAAGCCTTGTTACAAAATTACCACTGTGCACCCGATGAGCCTTTTATTCCTACGGATCTCATAGAAAATGTTGTGGCTGTTGCTGAGAACACAGCTGATGAGCTCGCCCGCAGTGATGGCAGAGACGTGCAGCTGGAGGAAGACCCAGACCTACAGCTGCCTTTTCTTCTGCCAGAAGATGGCTATTCCTGTGATGTTGTCAGAAACATTCCAAATGGTTTACAAGAATTTTTAGACCCTCTGTGCCAGAGAGGATTTTGTAGATTGGTTCCTCACACACGTTCACCAGGTACCTGGACAATATATTTTGAAGGAGCAGATTATGAAAGTCACCTTATGCGTGAGAACGCAGAACTGGCAACACCTCTGAGGAAGGAGCCTGAGATAATCACTGTGACTCTGAAGAAGCAGAATGGAATGGGCCTCAGCATCGTTGCAGCCAAGGGTGCTGGCCAGGATAAACTGGGAATCTACGTTAAGTCGGTTGTCAAAGGAGGTGCTGCAGATGTGGATGGACGATTAGCTGCTGGTGACCAACTCCTCAGTGTGGATGGACGAAGTCTGGTTGGACTTTCTCAGGAAAGGGCAGCAGAACTCATGACAAGAACCAGTTCCGTGGTTACACTGGAAGTTGCAAAGCAAGGTGCCATCTATCACGGCCTGGCCACCCTCCTTAACCAGCCGTCCCCCATGATGCAAAGAATTTCAGATCGTCGTGGCTCAGGTAAACCCAGACCAAAGAGTGAAGGTTTTGAGCTCTATAATAATTCAGCTCAAAATGGCTCCCCAGAGAGTCCTCAGATGCCTTGGACAGAGTACAGTGAGCCAAAGAAACTGCCTGGGGATGACAGGCTGATGAAAAACAGAGCGGACCACCGTTCCAGCCCCAATGTGGCAAATCAGCCTCCTAGCCCTGGAGGGAAGGGTCCATATACATCTGGAACAGCAGCTAAGATAACATCTGTCTCCACTGGAAACCTCTGCACTGAGGAGCAGTCCCCTCCACCCAGACCTGAAGCCTATCCTATCCCTACTCAGACATACACCAGAGAGTATTTTACCTTTCCAGCTTCAAAGTCGCAGGATCGGATGGCTCCTCCTCAGAGCCAGTGGCCAAATTATGAGGAAAAACCACATGTGCACACAGAAAGTAATCATTCCAGTATTGCAATCCAGGATTTGGAGTTTCATGGAGTCATGAGATTTTATTTTCAAGATAAAGCTGCTGGAAACTTTGCAACAAAATGTATTCGAGTCTCTAGCACAGCCACCACTCAAGATGTGATTGAAACACTGGCAGAGAAGTTCCGCCCTGACATGCGCATGCTCTCCTCTCCCAAGTACTCCCTCTATGAAGTGCATGTCAGTGGAGAAAGAAGATTGGACATTGATGAGAAACCTCTAGTTGTACAGTTGAATTGGAACAAAGATGATCGAGAGGGTCGATTCGTCCTTAAGAACGAGAATGACGCCATTCCTGCCAAGAAGGCTCAGAGTAATGGACCTGAAAAGCAGGAGAAAGAAGGTGTTATTCAGAACTTCAAAAGAACTCTCTCAAAGAAAGAAAAGAAGGAAAAAAAGAAGAAAGAGAAGGAGGCATTGAGACAAGCCTCTGATAAGGAAGAAAGGCCTTCTCAAGGGGATGACAGTGAGAACTCACGACTGGCTGCTGAAGTTTACAAAGACATGCCTGAGACCAGCTTTACTAGGACCATTTCTAACCCTGAAGTTGTCATGAAACGGCGGCGGCAGCAAAAACTGGAGAAGAGAATGCAAGAGTTTCGGAGCTCAGATGGGCGGCCTGACTCAGGTGGAACACTGAGGATATATGCAGATAGTTTAAAACCAAATATTCCATACAAGACAATCCTGCTGTCTACTACCGATACCGCAGACTTTGCTGTAGCCGAATCTTTGGAGAAGTATGGTCTGGAAAAAGAGAATCCCAAGGACTACTGTATTGCCCGGGTTATGCTTCCTCCTGGAGCCCAGCATTCTGATGAGAGAGGTGCTAAGGAAATAATTCTTGACGATGATGAATGTCCTTTACAAATCTTCAGGGAATGGCCAAGTGACAAAGGGATTTTAGTCTTTCAGTTGAAGAGGAGACCACCGGACTACATCCCAAAGAAAATGAAGAAACATGTTGAAGGGAAGTCGTTGAAGGGGAAAGACAGAGCTGACGGGTCTGGCTACGGCTCCGCTCTTCCTCCCGAGAAGCTGCCCTACTTAGTAGAGCTAAGCCCAGATGGCTCTGACTCCAGAGACAAGCCAAAGTTATACCGCCTTCAATTAAGTGTGACTGAAGTTGGGACAGAGAAATTTGATGACAATTCTATCCAGCTGTTTGGCCCCGGAATTCAGCCCCATCACTGTGATCTCACCAACATGGATGGAGTGGTCACTGTGACACCCAGAAGTATGGATGCAGAGACCTACGTGGATGGTCAGCGCATCTCAGAGACCACAATGCTGCAGAGTGGCATGAGACTGCAGTTTGGCACCTCGCATGTGTTTAAGTTTGTGGACCCCATCCAGGACCACGTTCTTTCCAAGAGATCTGTGGATGGAGGCCTGATGGTCAAGGGCCCAAGACATAAACCTGGAGCTGTTCAGGAGACAACCTTTGAATTGGGAGGAGATGTCCACAGTGGGACAGCATTGCCGGCAAGCAGGAGCACTACTAGACTGGACAGTGACAGGGTGTCCTCTGCCTCTAGCACAGCTGAGCGAGGGATGGTGAAGCCGATGATCCGACTGGACCAGGAGCAGGAATATCGACGACGAGAAAACAGGACTCAGGATGCTACTGGGCCTGAACTGATACTGCCTGCCAGCATTGAATTCAGGGAAAGCTCTGAAGACTCTTTTTTATCTGCCATTATAAACTATACCAATAGTTCTACAGTTCATTTTAAGTTGTCACCTACATATGTGTTATACATGGCATGCCGGTATGTATTGTCCAGCCAGCACAGGCCCGACATCAGTCCTACAGAGCGTACACATAAGGCCATTGCTGTTGTCAACAAGATGGTGAGCATGATGGAAGGGGTCATCCAGAAACAGAAGAACATTGCAGGAGCACTTGCTTTTTGGATGGCAAATGCATCTGAGCTTCTCAACTTCATCAAGCAGGACCGAGACCTTAGTCGGATCACGCTGGATGCCCAGGATGTCCTAGCACACTTGGTTCAGATGGCATTTAAGTACTTGGTTCATTGCCTTCAGTCAGAACTTAATAACTACATGCCAGCCTTTCTGGATGATCCTGAGGAGAACAGTCTGCAAAGACCAAAAATAGATGATGTGCTGCACACACTCACAGGAGCCATGTCCTTGCTGCGGCGCTGCAGAGTCAATGCTGCCTTGACCATCCAGCTCTTCTCTCAGCTTTTCCACTTCATCAATATGTGGCTGTTCAACAGACTGGTGACTGACCCAGATTCAGGCCTGTGCTCCCACTACTGGGGTGCCATTATCCGCCAGCAGCTGGGGCATATTGAAGCGTGGGCAGAGAAGCAGGGGCTAGAGCTGGCAGCTGACTGTCACTTGAGCAGAATTGTACAGGCTACAACATTGCTTACGATGGATAAGTATGTACCTGATGACATTCCAAATATAAACAGCACATGCTTTAAGTTAAATTCTCTGCAGCTTCAAGCCTTGTTACAAAATTACCACTGTGCACCCGATGAGCCTTTTATTCCTACGGATCTCATAGAAAATGTTGTGGCTGTTGCTGAGAACACAGCTGATGAGCTCGCCCGCAGTGATGGCAGAGACGTGCAGCTGGAGGAAGACCCAGACCTACAGCTGCCTTTTCTTCTGCCAGAAGATGGCTATTCCTGTGATGTTGTCAGAAACATTCCAAATGGTTTACAAGAATTTTTAGACCCTCTGTGCCAGAGAGGATTTTGTAGATTGGTTCCTCACACACGTTCACCAGGTACCTGGACAATATATTTTGAAGGAGCAGATTATGAAAGTCACCTTATGCGTGAGAACGCAGAACTGGCAACACCTCTGAGGAAGGAGCCTGAGATAATCACTGTGACTCTGAAGAAGCAGAATGGAATGGGCCTCAGCATCGTTGCAGCCAAGGGTGCTGGCCAGGATAAACTGGGAATCTACGTTAAGTCGGTTGTCAAAGGAGGTGCTGCAGATGTGGATGGACGATTAGCTGCTGGTGACCAACTCCTCAGTGTGGATGGACGAAGTCTGGTTGGACTTTCTCAGGAAAGGGCAGCAGAACTCATGACAAGAACCAGTTCCGTGGTTACACTGGAAGTTGCAAAGCAAGGTGCCATCTATCACGGCCTGGCCACCCTCCTTAACCAGCCGTCCCCCATGATGCAAAGAATTTCAGATCGTCGTGGCTCAGGTAAACCCAGACCAAAGAGTGAAGGTTTTGAGCTCTATAATAATTCAGCTCAAAATGGCTCCCCAGAGAGTCCTCAGATGCCTTGGACAGAGTACAGTGAGCCAAAGAAACTGCCTGGGGATGACAGGCTGATGAAAAACAGAGCGGACCACCGTTCCAGCCCCAATGTGGCAAATCAGCCTCCTAGCCCTGGAGGGAAGGGTCCATATACATCTGGAACAGCAGCTAAGATAACATCTGTCTCCACTGGAAACCTCTGCACTGAGGAGCAGTCCCCTCCACCCAGACCTGAAGCCTATCCTATCCCTACTCAGACATACACCAGAGAGTATTTTACCTTTCCAGCTTCAAAGTCGCAGGATCGGATGGCTCCTCCTCAGAGCCAGTGGCCAAATTATGAGGAAAAACCACATGTGCACACAGAAAGTAATCATTCCAGTATTGCAATCCAG

Peptide sequence:

MRFYFQDKAAGNFATKCIRVSSTATTQDVIETLAEKFRPDMRMLSSPKYSLYEVHVSGERRLDIDEKPLVVQLNWNKDDREGRFVLKNENDAIPAKKAQSNGPEKQEKEGVIQNFKRTLSKKEKKEKKKKEKEALRQASDKEERPSQGDDSENSRLAAEVYKDMPETSFTRTISNPEVVMKRRRQQKLEKRMQEFRSSDGRPDSGGTLRIYADSLKPNIPYKTILLSTTDTADFAVAESLEKYGLEKENPKDYCIARVMLPPGAQHSDERGAKEIILDDDECPLQIFREWPSDKGILVFQLKRRPPDYIPKKMKKHVEGKSLKGKDRADGSGYGSALPPEKLPYLVELSPDGSDSRDKPKLYRLQLSVTEVGTEKFDDNSIQLFGPGIQPHHCDLTNMDGVVTVTPRSMDAETYVDGQRISETTMLQSGMRLQFGTSHVFKFVDPIQDHVLSKRSVDGGLMVKGPRHKPGAVQETTFELGGDVHSGTALPASRSTTRLDSDRVSSASSTAERGMVKPMIRLDQEQEYRRRENRTQDATGPELILPASIEFRESSEDSFLSAIINYTNSSTVHFKLSPTYVLYMACRYVLSSQHRPDISPTERTHKAIAVVNKMVSMMEGVIQKQKNIAGALAFWMANASELLNFIKQDRDLSRITLDAQDVLAHLVQMAFKYLVHCLQSELNNYMPAFLDDPEENSLQRPKIDDVLHTLTGAMSLLRRCRVNAALTIQLFSQLFHFINMWLFNRLVTDPDSGLCSHYWGAIIRQQLGHIEAWAEKQGLELAADCHLSRIVQATTLLTMDKYVPDDIPNINSTCFKLNSLQLQALLQNYHCAPDEPFIPTDLIENVVAVAENTADELARSDGRDVQLEEDPDLQLPFLLPEDGYSCDVVRNIPNGLQEFLDPLCQRGFCRLVPHTRSPGTWTIYFEGADYESHLMRENAELATPLRKEPEIITVTLKKQNGMGLSIVAAKGAGQDKLGIYVKSVVKGGAADVDGRLAAGDQLLSVDGRSLVGLSQERAAELMTRTSSVVTLEVAKQGAIYHGLATLLNQPSPMMQRISDRRGSGKPRPKSEGFELYNNSAQNGSPESPQMPWTEYSEPKKLPGDDRLMKNRADHRSSPNVANQPPSPGGKGPYTSGTAAKITSVSTGNLCTEEQSPPPRPEAYPIPTQTYTREYFTFPASKSQDRMAPPQSQWPNYEEKPHVHTESNHSSIAIQDLEFHGVMRFYFQDKAAGNFATKCIRVSSTATTQDVIETLAEKFRPDMRMLSSPKYSLYEVHVSGERRLDIDEKPLVVQLNWNKDDREGRFVLKNENDAIPAKKAQSNGPEKQEKEGVIQNFKRTLSKKEKKEKKKKEKEALRQASDKEERPSQGDDSENSRLAAEVYKDMPETSFTRTISNPEVVMKRRRQQKLEKRMQEFRSSDGRPDSGGTLRIYADSLKPNIPYKTILLSTTDTADFAVAESLEKYGLEKENPKDYCIARVMLPPGAQHSDERGAKEIILDDDECPLQIFREWPSDKGILVFQLKRRPPDYIPKKMKKHVEGKSLKGKDRADGSGYGSALPPEKLPYLVELSPDGSDSRDKPKLYRLQLSVTEVGTEKFDDNSIQLFGPGIQPHHCDLTNMDGVVTVTPRSMDAETYVDGQRISETTMLQSGMRLQFGTSHVFKFVDPIQDHVLSKRSVDGGLMVKGPRHKPGAVQETTFELGGDVHSGTALPASRSTTRLDSDRVSSASSTAERGMVKPMIRLDQEQEYRRRENRTQDATGPELILPASIEFRESSEDSFLSAIINYTNSSTVHFKLSPTYVLYMACRYVLSSQHRPDISPTERTHKAIAVVNKMVSMMEGVIQKQKNIAGALAFWMANASELLNFIKQDRDLSRITLDAQDVLAHLVQMAFKYLVHCLQSELNNYMPAFLDDPEENSLQRPKIDDVLHTLTGAMSLLRRCRVNAALTIQLFSQLFHFINMWLFNRLVTDPDSGLCSHYWGAIIRQQLGHIEAWAEKQGLELAADCHLSRIVQATTLLTMDKYVPDDIPNINSTCFKLNSLQLQALLQNYHCAPDEPFIPTDLIENVVAVAENTADELARSDGRDVQLEEDPDLQLPFLLPEDGYSCDVVRNIPNGLQEFLDPLCQRGFCRLVPHTRSPGTWTIYFEGADYESHLMRENAELATPLRKEPEIITVTLKKQNGMGLSIVAAKGAGQDKLGIYVKSVVKGGAADVDGRLAAGDQLLSVDGRSLVGLSQERAAELMTRTSSVVTLEVAKQGAIYHGLATLLNQPSPMMQRISDRRGSGKPRPKSEGFELYNNSAQNGSPESPQMPWTEYSEPKKLPGDDRLMKNRADHRSSPNVANQPPSPGGKGPYTSGTAAKITSVSTGNLCTEEQSPPPRPEAYPIPTQTYTREYFTFPASKSQDRMAPPQSQWPNYEEKPHVHTESNHSSIAIQ

IRESfinder result

IRESfinder score

0.469720151

IRES/non IRES

non-IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page