top of page

mmu_circAdgrl3_1714

Basic information of circular RNA
PanCircBase ID:

mmu_circAdgrl3_1714

mm39_Chr. Position ID:

chr5|81836355|81922278|+

Gene name:

Adgrl3

Transcript:

ENSMUST00000117253.8

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

12

Exon/intron indexes:

14,15,16,17,18,19,20,21,22,23,24,25

Exon/intron offsets:

0,1056,4984,5942,35553,38160,50518,52546,72118,77629,83075,85884

Genomic length:

85923

Exon/intron sizes in nt:

184,123,209,177,210,221,67,92,169,126,97,39

Flanking exon/introns:

chr5:81811271-81836355|chr5:81922278-81935282

Splice length:

1714

Other database IDs:

circAtlas: hsa-ADGRL3_0039

Human Ortholog IDs:
Mature spliced Sequence:

GCGATGGTGGAGACAGTTAACAACCTCCTTCAGCCACAAGCTTTGAATGCCTGGAGAGACCTGACGACAAGTGATCAACTGCGTGCGGCCACCATGTTGCTTGACACTGTGGAGGAGAGCGCTTTCGTGTTAGCTGATAACCTTTTGAAGACCGACATTGTCAGGGAGAATACAGACAATATTCAGTTAGAAGTTGCAAGACTGAGCACGGAAGGAAACCTAGAAGATCTAAAATTCCCAGAGAACATGGGCCACGGAAGTACCATCCAGCTCTCAGCAAACACATTAAAGCAAAATGGCCGGAATGGAGAGATTAGAGTGGCTTTTGTCCTGTATAATAACCTGGGTCCTTATTTGTCTACGGAGAATGCCAGTATGAAGTTGGGCACAGAAGCTATGTCCACAAATCACTCGGTTATCGTCAATTCCCCTGTTATTACAGCAGCAATAAATAAGGAATTCAGTAATAAAGTGTATTTGGCTGATCCTGTGGTATTTACTGTTAAACACATCAAGCAGTCAGAAGAAAATTTCAACCCTAACTGTTCATTTTGGAGCTATTCCAAGCGCACAATGACAGGTTATTGGTCAACACAAGGCTGTCGACTCCTGACAACCAACAAGACACATACTACATGCTCCTGTAACCACCTCACCAACTTTGCAGTATTGATGGCACATGTGGAAGTTAAGCACAGCGATGCAGTCCACGATCTTCTTCTGGATGTGATCACGTGGGTTGGCATCTTGCTGTCCCTTGTCTGTCTCCTGATTTGCATCTTCACATTCTGCTTCTTCCGGGGACTCCAGAGTGACCGCAACACCATTCACAAGAACCTCTGCATCAGCCTGTTCGTGGCAGAACTGCTCTTCCTGATTGGAATCAACAGAACCGACCAACCAATTGCCTGTGCAGTGTTCGCGGCTCTTTTGCATTTCTTCTTCTTGGCGGCCTTCACCTGGATGTTTCTAGAAGGGGTGCAGCTGTATATCATGCTGGTGGAGGTCTTTGAGAGCGAGCATTCCCGTAGGAAGTACTTTTATCTGGTCGGCTATGGGATGCCCGCGCTCATCGTGGCCGTTTCTGCGGCCGTCGACTACAGGAGCTACGGAACAGACAAAGTATGTTGGCTTCGCCTTGACACCTACTTCATTTGGAGTTTTATAGGACCGGCGACCTTGATAATTATGCTGAATGTCATCTTCCTTGGGATTGCTTTATACAAAATGTTTCACCATACTGCCATACTGAAACCTGAATCAGGCTGTCTTGACAATATCAAGTCATGGGTTATAGGTGCAATAGCTCTGCTCTGCCTGTTAGGATTGACCTGGGCCTTTGGACTCATGTATATTAATGAAAGCACAGTCATCATGGCGTATCTCTTCACCATTTTCAATTCTCTACAGGGAATGTTTATATTCATTTTCCACTGTGTTCTACAGAAGAAGGTACGGAAAGAGTATGGGAAATGCCTCCGCACGCATTGCTGTAGTGGGAAAAGCACGGAGAGTTCGATTGGCTCAGGGAAAACATCTGGTTCTCGAACTCCAGGACGGTACTCCACAGGCTCGCAGAGCCGGATTCGGAGAATGTGGAATGACACTGTCCGAAAGCAGTCAGAGTCGTCCTTCATCACCGGAGACATAAACAGCTCAGCATCGCTCAACAGAGGATATCTTCCCTGCATGCAGGCCTGTGTAACCTATGTAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

GTCGTCCTTCATCACCGGAG

60.18

AGGCATTCAAAGCTTGTGGC

59.68

141

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

GAGTCGTCCTTCATCACCGG

60.18

AGGCATTCAAAGCTTGTGGC

59.68

143

PCR template sequence:

AAGCAGTCAGAGTCGTCCTTCATCACCGGAGACATAAACAGCTCAGCATCGCTCAACAGAGGATATCTTCCCTGCATGCAGGCCTGTGTAACCTATGTAGGCGATGGTGGAGACAGTTAACAACCTCCTTCAGCCACAAGCTTTGAATGCCTGGAGAGACCTGACGACAAGTGATCAACTGCGTGCGGCCACCATGTTGC

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

21

Interacting miRNAs (#binding sites)

mmu-miR-200c-3p(2), mmu-miR-670-5p(2), mmu-miR-137-3p(1), mmu-miR-200a-3p(1), mmu-miR-141-3p(1), mmu-miR-1a-3p(1), mmu-miR-200b-3p(1), mmu-miR-181a-5p(1), mmu-miR-31-5p(1), mmu-miR-92a-3p(1), mmu-miR-324-5p(1), mmu-miR-25-3p(1), mmu-miR-363-3p(1), mmu-miR-125a-5p(1), mmu-miR-494-3p(1), mmu-miR-676-3p(1), mmu-miR-218-5p(1), mmu-miR-340-5p(1), mmu-miR-1198-5p(1), mmu-miR-3470b(1), mmu-miR-181d-5p(1)

siRNAs for circular RNA silencing
Junction sequence

GTAACCTATGTAGGCGATGGTGGAGA

siRNA sets

CCACCATCGCCTACATAGG

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCADGRL3_1714_ORF_1

0.9716

0.158409758

0.999933799

1731

ORF sequence:

ATGGTGGAGACAGTTAACAACCTCCTTCAGCCACAAGCTTTGAATGCCTGGAGAGACCTGACGACAAGTGATCAACTGCGTGCGGCCACCATGTTGCTTGACACTGTGGAGGAGAGCGCTTTCGTGTTAGCTGATAACCTTTTGAAGACCGACATTGTCAGGGAGAATACAGACAATATTCAGTTAGAAGTTGCAAGACTGAGCACGGAAGGAAACCTAGAAGATCTAAAATTCCCAGAGAACATGGGCCACGGAAGTACCATCCAGCTCTCAGCAAACACATTAAAGCAAAATGGCCGGAATGGAGAGATTAGAGTGGCTTTTGTCCTGTATAATAACCTGGGTCCTTATTTGTCTACGGAGAATGCCAGTATGAAGTTGGGCACAGAAGCTATGTCCACAAATCACTCGGTTATCGTCAATTCCCCTGTTATTACAGCAGCAATAAATAAGGAATTCAGTAATAAAGTGTATTTGGCTGATCCTGTGGTATTTACTGTTAAACACATCAAGCAGTCAGAAGAAAATTTCAACCCTAACTGTTCATTTTGGAGCTATTCCAAGCGCACAATGACAGGTTATTGGTCAACACAAGGCTGTCGACTCCTGACAACCAACAAGACACATACTACATGCTCCTGTAACCACCTCACCAACTTTGCAGTATTGATGGCACATGTGGAAGTTAAGCACAGCGATGCAGTCCACGATCTTCTTCTGGATGTGATCACGTGGGTTGGCATCTTGCTGTCCCTTGTCTGTCTCCTGATTTGCATCTTCACATTCTGCTTCTTCCGGGGACTCCAGAGTGACCGCAACACCATTCACAAGAACCTCTGCATCAGCCTGTTCGTGGCAGAACTGCTCTTCCTGATTGGAATCAACAGAACCGACCAACCAATTGCCTGTGCAGTGTTCGCGGCTCTTTTGCATTTCTTCTTCTTGGCGGCCTTCACCTGGATGTTTCTAGAAGGGGTGCAGCTGTATATCATGCTGGTGGAGGTCTTTGAGAGCGAGCATTCCCGTAGGAAGTACTTTTATCTGGTCGGCTATGGGATGCCCGCGCTCATCGTGGCCGTTTCTGCGGCCGTCGACTACAGGAGCTACGGAACAGACAAAGTATGTTGGCTTCGCCTTGACACCTACTTCATTTGGAGTTTTATAGGACCGGCGACCTTGATAATTATGCTGAATGTCATCTTCCTTGGGATTGCTTTATACAAAATGTTTCACCATACTGCCATACTGAAACCTGAATCAGGCTGTCTTGACAATATCAAGTCATGGGTTATAGGTGCAATAGCTCTGCTCTGCCTGTTAGGATTGACCTGGGCCTTTGGACTCATGTATATTAATGAAAGCACAGTCATCATGGCGTATCTCTTCACCATTTTCAATTCTCTACAGGGAATGTTTATATTCATTTTCCACTGTGTTCTACAGAAGAAGGTACGGAAAGAGTATGGGAAATGCCTCCGCACGCATTGCTGTAGTGGGAAAAGCACGGAGAGTTCGATTGGCTCAGGGAAAACATCTGGTTCTCGAACTCCAGGACGGTACTCCACAGGCTCGCAGAGCCGGATTCGGAGAATGTGGAATGACACTGTCCGAAAGCAGTCAGAGTCGTCCTTCATCACCGGAGACATAAACAGCTCAGCATCGCTCAACAGAGGATATCTTCCCTGCATGCAGGCCTGTGTAACCTATGTAGGCGATGGTGGAGACAGTTAA

Peptide sequence:

MVETVNNLLQPQALNAWRDLTTSDQLRAATMLLDTVEESAFVLADNLLKTDIVRENTDNIQLEVARLSTEGNLEDLKFPENMGHGSTIQLSANTLKQNGRNGEIRVAFVLYNNLGPYLSTENASMKLGTEAMSTNHSVIVNSPVITAAINKEFSNKVYLADPVVFTVKHIKQSEENFNPNCSFWSYSKRTMTGYWSTQGCRLLTTNKTHTTCSCNHLTNFAVLMAHVEVKHSDAVHDLLLDVITWVGILLSLVCLLICIFTFCFFRGLQSDRNTIHKNLCISLFVAELLFLIGINRTDQPIACAVFAALLHFFFLAAFTWMFLEGVQLYIMLVEVFESEHSRRKYFYLVGYGMPALIVAVSAAVDYRSYGTDKVCWLRLDTYFIWSFIGPATLIIMLNVIFLGIALYKMFHHTAILKPESGCLDNIKSWVIGAIALLCLLGLTWAFGLMYINESTVIMAYLFTIFNSLQGMFIFIFHCVLQKKVRKEYGKCLRTHCCSGKSTESSIGSGKTSGSRTPGRYSTGSQSRIRRMWNDTVRKQSESSFITGDINSSASLNRGYLPCMQACVTYVGDGGDS

IRESfinder result

IRESfinder score

0.551848454

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page