top of page

mmu_ciPikfyve_1301

Basic information of circular RNA
PanCircBase ID:

mmu_ciPikfyve_1301

mm39_Chr. Position ID:

chr1|65289445|65290746|+

Gene name:

Pikfyve

Transcript:

ENSMUST00000081154.14

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

21

Exon/intron offsets:

0

Genomic length:

1301

Exon/intron sizes in nt:

1301

Flanking exon/introns:

chr1:65289445-65290763

Splice length:

1301

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTAGGATGCTTGTGTGCACTAGTGCACCTAGTAGTGGAATTCCAATAACATAAATAATGCCTGCTTTTAGTTATGATACATTGATGGTCACATGTGAATTGATAGAATATTTAAACTTATAAAGTAACCGTGAAGGGTTTTTGTTCATGAATAAATAATTGTACCTTAAGTAAGAATGAAAAAAATTCAGAGAGAGGAAAGAGAAATGTTTGTATTATAGAACTTACAAAGTTGATCCACAAAAGCTGGTTTTTGAAACCAAAAGTCTACATTTTGATTATAAGCATGTACAATTTAGGTAGGTTTCCCTTTGCATAGTGTTATAAAAGAGTCAGCCGTTTATCTTACTGTTTGTAGTTCTACCACTGAGTTATACTACCAGACCAACCTTTTGTCTCATTAGTGTGTTCTTCTTGTAAATGTCTTAAATAAATTTATAGAGACAAACACATTTTATAATGTTGTAATATTTCTAGTGATAGCCATAAAGACCTTACATGCCTGTTAGGTTTTTGTTGTTATGTTAAAAAATTATCTGTCAAAAGCAGCCTAAAGGAGAAAGGGTTATTTGGTTCATAGTTGAAGGATACAGTCCTTCATGGCAGGGAAAGTCACAGAAGCTAGAGCTTGAAGTAACTGATGATAGGAAGCCAGCATTCAGGGGAAAGCATTGAATGCATGCACGGATGCTGTGCTCAGCCTCACTCCCTTTCTCATTGTTGTTTGTTTTTGGTAATGCTGCTTCCATAATAAAATATTTATCTCCAACAAAAATTTTTTTCTTGAAGCTTGTGTAGTTCCAGGACAACTTTAAGCATGATTTTCTGAAAGTGTGTAGGGTTTTTTTCCCTTAGAAATTAATGGACTCCTTAGGTAATACTAAGGATACAGATTTTAACAAGCGTACATGCAAAGTCTCTAATTTTGGTTAGTTGTGTTACGTACAGTTAGGAGCTGTTTTCCATACTCAGTGACTAGAGGGCAGAAGAGCACTGTCTTTTTTTTTTCTCCCCAATGTTGATTGGGATTGAAACTGAAAGACAGTTTTACCTCTTCCTAATGCAAATCAGTTTTATTCCACTTATTTTACAGTTTGTGCATTCTCATTAAATAATTTTTTAAAGATACTAACGAAATAGGAGTGGAAACGATGCTATAGTGTGGCTAGTCTACACTTGTTTGACAGAATGAGGTAAAACCTGTTCCACAGCATCATTAGATATGTTTTTCTTTAGTACTTCATCATAAGCATATTTAATAATTAGAATATAGTCTTTGTGGTAATGTTGCCATATTTCTAA

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

GTTCCACAGCATCATTAGATATGT

56.88

TGGAATTCCACTACTAGGTGCAC

60.06

144

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

GTTCCACAGCATCATTAGATATGT

56.88

TGGAATTCCACTACTAGGTGCA

58.82

144

PCR template sequence:

GTTCCACAGCATCATTAGATATGTTTTTCTTTAGTACTTCATCATAAGCATATTTAATAATTAGAATATAGTCTTTGTGGTAATGTTGCCATATTTCTAAGTAGGATGCTTGTGTGCACTAGTGCACCTAGTAGTGGAATTCCAATAACATAAATAATGCCTGCTTTTAGTTATGATACATTGATGGTCACATGTGAATT

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

13

Interacting miRNAs (#binding sites)

mmu-miR-103-3p(2), mmu-miR-107-3p(2), mmu-miR-18a-5p(1), mmu-miR-29b-1-5p(1), mmu-miR-411-3p(1), mmu-miR-382-5p(1), mmu-miR-29b-2-5p(1), mmu-miR-300-3p(1), mmu-miR-369-3p(1), mmu-miR-335-3p(1), mmu-miR-3065-5p(1), mmu-miR-544-5p(1), mmu-miR-7a-2-3p(1)

siRNAs for circular RNA silencing
Junction sequence

GCCATATTTCTAAGTAGGATGCTTGT

siRNA sets

ATCCTACTTAGAAATATGG, TCCTACTTAGAAATATGGC, CATCCTACTTAGAAATATG

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.882510969

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page