top of page

mmu_ciPclo_1738

Basic information of circular RNA
PanCircBase ID:

mmu_ciPclo_1738

mm39_Chr. Position ID:

chr5|14842106|14843844|+

Gene name:

Pclo

Transcript:

ENSMUST00000182407.8

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

19

Exon/intron offsets:

0

Genomic length:

1738

Exon/intron sizes in nt:

1738

Flanking exon/introns:

chr5:14842106-14843845

Splice length:

1738

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTAGGAGATATTTCATGTAGAGCACCGTTGTTTTTCTATTTGTTCAGTCAGTAGCTTCTCGAACGTGAGTGTCTCTATGTTTAATATACACTGTAAAGTTGGGTTCTGTTGGAAAATAGTGTGATATAATGAAAAGTGTGCTCCTGGTTAGGAAGAAAGGGGCTTTAGGCAAATACCAGCACATACTTAGGTGTTAGTCTTGCCAGCTTCATTTCCTTACTTTGTAAAAGTCATACTGGCCTACATAAGGTAATCCTATTTCATGAAACACATAACAGTAGAATTTCAGAGAATTCACTGATCTATCTCAAAAAAGAGTATAAAGTTCCTTCTGCTATCTTTACTAGAAATATGGCCATCATTACTATTAAGTATATTCTTTTTAATTTTTTTCAATCTCTGAATTCTCATATTGCCAGTCTATAACTAAAATTCTGCATCCTGTTTTTACTTGTCCTTTGAAGAACATTTTCCCCACATTACCAAAACCAACAGCAACTCAAATTCTTCAAGTCTTTCCTAAATGTTGGATCCCAACTAAAAATCGTGTTACACATCCACATGGTGCTTAGCAATATGCACCACATTTCTATAATGAGCTCTCCCTTTAGCTTTTTAAACCACTGTTCTACAAGATAACCAATCCTCCCATCAGTGATAAATCCACAAACCTGTATGAGATAAACGTGTGGTGACAGCATGCATTAATATTTGTAAATATTAAAGACGATTAGTGAGCACTGTTGCCTTCTGGAAGTGCTTCCATGTGCACCAGAAGCAGGCAGACTGTGTCACAGTGTTCTGGAGGGTGAAAAACTAGGGTCACCTCTAATAGTCCGACCACAGAAAAAGTACTGAAGATGTTTTCTGAGGATGTATGATAGACTGGGTTCGAATTCGACTTAGCCATTTAAACTTCGCCATGCTAAACATTCTGAAAGATAATTGACATGTAGATCTCTCTGTCTCTCTCTGTCCCACTGTCTCTGTGTCTCTGTCTCTCTTTATTTATGTATGTGTCTGGGTGTGGGTGTGGGTGTAGTTCTCGCCATCTACAGTCTCAGTTTCCTGAGACAATGATTCTATAACATTATTTAGATTCTAATAAGTTCTACTGCTAACCCAGAATCCACTCTGTTTTTACTTAAGCATGCCCCATATCTCTGTAGACGCATTGTGTTGTACTAGCCTCTACTAGAATAAGCAGAGCTGTAGGGAAGATGGGGCTGAGACATCTGTTCCCTGAGGCTTCTGAGAACTCATTTTCCTTTTTTCTTTTCTTAATAATTAGTTATTGATTATTTGGGAATTTCACATAATATACCCCATCCCACTTCCAGTCCTCCCAGGTCCAGCCCCTTGTACACTCTCCCACAAAAAAAGCAGAAAGATGAAAAAAGAAATAAAGGAAGGAAGGAAGGAAGGAAGGAAAGAAGGAGGGAAGGAGGGAAGGAGGGAAGGAGGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAGGGAAGGAAGGAAGAAGTTTCTTCTCCAGACTGGCCTCCCTTACTTCCTTTCCTGACTTGTTCTTTAAATGCTTAATACCATTACTCAATTGTGTGGAGTGGCACAAATGGCACAAAAAGACAGCATTGATGTAAAAGACTGTTTCCAGTTACATGTAGACTAGACTTTCACAGCAAGGCACTGGGCAGCAACTTTAACTCACTTTTTTATTCCTTTGTAACCA

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

CTTTCACAGCAAGGCACTGG

59.69

AACATAGAGACACTCACGTTCGA

59.5

140

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

ACTAGACTTTCACAGCAAGGCA

59.9

AGAGACACTCACGTTCGAGA

58.12

141

PCR template sequence:

CATTGATGTAAAAGACTGTTTCCAGTTACATGTAGACTAGACTTTCACAGCAAGGCACTGGGCAGCAACTTTAACTCACTTTTTTATTCCTTTGTAACCAGTAGGAGATATTTCATGTAGAGCACCGTTGTTTTTCTATTTGTTCAGTCAGTAGCTTCTCGAACGTGAGTGTCTCTATGTTTAATATACACTGTAAAGTT

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

17

Interacting miRNAs (#binding sites)

mmu-miR-137-3p(1), mmu-miR-141-3p(1), mmu-miR-7b-5p(1), mmu-miR-31-5p(1), mmu-miR-29b-3p(1), mmu-miR-29a-3p(1), mmu-miR-29c-3p(1), mmu-miR-146a-5p(1), mmu-miR-132-3p(1), mmu-miR-709(1), mmu-miR-127-5p(1), mmu-miR-182-5p(1), mmu-miR-511-3p(1), mmu-miR-340-5p(1), mmu-miR-335-3p(1), mmu-miR-1904(1), mmu-miR-146b-5p(1)

siRNAs for circular RNA silencing
Junction sequence

TCCTTTGTAACCAGTAGGAGATATTT

siRNA sets

AAATATCTCCTACTGGTTA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.879593586

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page