top of page

mmu_ciPcdh9_1232

Basic information of circular RNA
PanCircBase ID:

mmu_ciPcdh9_1232

mm39_Chr. Position ID:

chr14|94126324|94127556|-

Gene name:

Pcdh9

Transcript:

ENSMUST00000192221.6

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

1

Exon/intron offsets:

0

Genomic length:

1232

Exon/intron sizes in nt:

1232

Flanking exon/introns:

chr14:94125797-94127556

Splice length:

1232

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTAAGTGTAAAGTTTCGCATTAACAATTCGAAATACCGTCTTTAGTTGTGTCCTCGGCGTAGATGAGAGGTGTTTGTAATTGGGTAGCTGGCTAGGGTAGAGCTCGCCTACTGGGTTGTATCTGCATCCCCACCTGCACCACTCAGCTGGAACTAATCGCGGGCATCAGCTACTGTGTAGCCTAATGCAGATAAGATTAGAGCCTGGGAGCTGACCAGTCTTACTCCGGGTGGGTAGCTGCCTGGAGCCTTGCACCCATTTAAACTGCAGTTAGAGGGGCATCTGAGCGGAAGTTCTTCTACGTGTGTTACCGGGTTGCGGTATTTATGTGTAGCAAATGTTACTAATATTCTAATGAGACACCGGATTAAGAAACTGCATTTTTGTTCTTTTATGCTCAATAGAAAAAAAAATACCGTGATGTTACATAGGAATGTTGTCTGTGTTTCACTTCCATCCCGGCATGCTGGTCCACCTCTGTGATAAGCAATTGTCTATTAGGATACGTTTTTTAAAAAGTTTTAATGTGTTTATTTATCTCAACGGGGGCAATGTGGAAATATGGAGAAAGGAGAGCACCCTCCGAGGAAGAAATGCCAAGTCTTGGTTTTGTGCTTTGAGGCAATGAGAACCCTTAGTGGCCAGTGACTACTGCTGTTGCTGCGGCTGCAGCAGCATGTCCGAATGCTCATTTTCCAGGAGGGTTGGATTATGAGACAGTTGAAGAACTGGGAGGAAGGAAAAGCAGTCTTTTGAGAGGAGGAGATGACTCAGTGTGGCAGAGAAGAAAACACATCATATCTAACATGTGACAAAGCAGTTGGCAGCAATCATAGCTAAATACTTGAGCTCTTTCCATCGCAAACAACTAGGGGAGGTGGGCTAGAGACCAGGAGGAGGGTTAAATGGGGGTGGGGGGTGTGTGGGAAAGCAAAATAAGAATGCACACTTTGAATTAAACAGTGTTATAATAAAACCAAAACAGTGTGGGGGTGGGGGGATTCCAGGTAAAAATAGCTGCTGCTGTCCTTAATTCAAAAGTAGATGAATTTCATTTTCTCTGGGCAAATGCAACAAGCAGGGGATATTCAGTGGCCACAGAGTTAACTTACAAACTGTGGCAGAGCAAACTGCCATGTTTACTAATGTGCAGGGAGAGTGTGCTTCGATGTTTTGGTGACTGTGTTTTCATTTACTGAAGAATAATATTGTCTGTACAATTGTGTTGACAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

GGGAGAGTGTGCTTCGATGT

59.75

CTCATCTACGCCGAGGACAC

59.97

147

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

GGGAGAGTGTGCTTCGATGT

59.75

CTACCCTAGCCAGCTACCCA

60.11

180

PCR template sequence:

GCCATGTTTACTAATGTGCAGGGAGAGTGTGCTTCGATGTTTTGGTGACTGTGTTTTCATTTACTGAAGAATAATATTGTCTGTACAATTGTGTTGACAGGTAAGTGTAAAGTTTCGCATTAACAATTCGAAATACCGTCTTTAGTTGTGTCCTCGGCGTAGATGAGAGGTGTTTGTAATTGGGTAGCTGGCTAGGGTAG

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

10

Interacting miRNAs (#binding sites)

mmu-miR-200a-3p(1), mmu-miR-141-3p(1), mmu-miR-322-5p(1), mmu-miR-30d-5p(1), mmu-miR-199b-3p(1), mmu-miR-199a-3p(1), mmu-miR-382-5p(1), mmu-miR-207(1), mmu-miR-193b-3p(1), mmu-miR-338-3p(1)

siRNAs for circular RNA silencing
Junction sequence

ATTGTGTTGACAGGTAAGTGTAAAGT

siRNA sets

TACACTTACCTGTCAACAC, ACTTTACACTTACCTGTCA, TTACACTTACCTGTCAACA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.683938382

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page