top of page

mmu_ciParp12_222

Basic information of circular RNA
PanCircBase ID:

mmu_ciParp12_222

mm39_Chr. Position ID:

chr6|39070339|39070561|-

Gene name:

Parp12

Transcript:

ENSMUST00000038398.7

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

8

Exon/intron offsets:

0

Genomic length:

222

Exon/intron sizes in nt:

222

Flanking exon/introns:

chr6:39068314-39070561

Splice length:

222

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTAAGTGACATTTGTGCGCTGGCTTGGTATGTGGTTTTAGTTGAGGAGTGCTTTGCTTTCAGTTACAGGAAGCTTCTCAGACTGCATGGAAGGGTACTGACTAGCATGTGTGACTAGCATGCTACTGTCTTTCAAACCTACTAGTTGGGAAAGTCTTTAAGCCACAGTGAGAATTAGCATTGTGGGTTTCATCAAGGCTATTTAGTGAGATGTGCAAACCTG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

CATTGTGGGTTTCATCAAGGCT

59.44

ACCCTTCCATGCAGTCTGAG

59.38

140

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

AGCATTGTGGGTTTCATCAAGG

59.44

ACCCTTCCATGCAGTCTGAG

59.38

142

PCR template sequence:

TACTGTCTTTCAAACCTACTAGTTGGGAAAGTCTTTAAGCCACAGTGAGAATTAGCATTGTGGGTTTCATCAAGGCTATTTAGTGAGATGTGCAAACCTGGTAAGTGACATTTGTGCGCTGGCTTGGTATGTGGTTTTAGTTGAGGAGTGCTTTGCTTTCAGTTACAGGAAGCTTCTCAGACTGCATGGAAGGGTACTGA

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

2

Interacting miRNAs (#binding sites)

mmu-miR-155-5p(1), mmu-miR-32-5p(1)

siRNAs for circular RNA silencing
Junction sequence

ATGTGCAAACCTGGTAAGTGACATTT

siRNA sets

AAATGTCACTTACCAGGTT, TCACTTACCAGGTTTGCAC, ATGTCACTTACCAGGTTTG

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.867259201

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page