top of page

mmu_ciP3h2_1099

Basic information of circular RNA
PanCircBase ID:

mmu_ciP3h2_1099

mm39_Chr. Position ID:

chr16|25787554|25788653|-

Gene name:

P3h2

Transcript:

ENSMUST00000039990.6

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

12

Exon/intron offsets:

0

Genomic length:

1099

Exon/intron sizes in nt:

1099

Flanking exon/introns:

chr16:25787554-25788653

Splice length:

1099

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTAAGGATGCCCCTACTCAACCCTCGGTGGGAAGAGGGAAGTGGGAAGATGCTCTGCTTGCTTCCTCGTTCATTTCTGTGAAGCAGAGTCCTCCAGGAATCACCTGGAGCCTTCTCCTTTTTATCTTAAGCATCATGCACATTTTCCCTCCTTTTCCTTAGACCAACTGCTCTCTAAATCACTTTGTTTCACTAAGGCATAGCATTTTGCATGTGTTTCCCACTCGGAGAGCACACAGGCATGGTCCCTTAACATACATAACATATTATCACATGCATGTGTATTATTCACACCAAGAACCGTGTCTACATTTTTCCATTATGAAAACAGAAACGTTGGGAAATAACTCAGGTTTCTTTAAGGGGTTGGCCACTGAGAGTTTGACCAATGAGTAGTATATGGTCAACACTAAATTGTTTTTTGTTTTTCTTCTTTTTTGGGGGGATAGGTCAAAAGGTTAGAGATGGGAAGACCTGGAAGGTCAGGGTACATGGTGTGAAATTCACAGGTATTCAATAAAAATATTGTGTTGGGAAAAGTAAAAGAAAATAGAAACTCACAAGGGAATACTGTTGTATAGTTTGAGGAGATATGTTAGTACACAAAGAAGATATCCTAGCATGAAACAGTGCATCTTAATATGTAGTGACTATTAATACTTAACAACATGGCAGTTGCTATGTTGTATTTTATTCAAAACATTTAGTGTGCAGTCCTTATCTGAGTGACCATGCTAGATCACAAGGAATTCATTGCCTAAGCTAAGGAAAGAAAGCCCATCCCCCAAGGTTCCTTTTATATCTGGGAAAACGAGGGTTATAAGCAATGTGGCTGGATTTAGAAGCTATCTGAAATCAAGCCTGACTAACTGTTGACAATGTCAAATGAGCATTGAAACAAGGCCAAAACCATATGGAAACGGAACCAATAAGCATCCAGAGTATAAGCCAGACACCCCTGAGCTTAATTTCAAGGGTTGGGGGGACCAACATCAAAGGTAACTCCCCATTCAGGTGGCTCCCTTCACTGGTCGTCTGTATTTTACTATGAGGCTGCTGAGGACTGTATTGTCACTGACTGCCCCACCCCCTCCTTGCAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

CTCCCTTCACTGGTCGTCTG

59.76

TCCTGGAGGACTCTGCTTCA

59.88

180

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

TGAGGCTGCTGAGGACTGTA

60.25

TCCTGGAGGACTCTGCTTCA

59.88

150

PCR template sequence:

AACTCCCCATTCAGGTGGCTCCCTTCACTGGTCGTCTGTATTTTACTATGAGGCTGCTGAGGACTGTATTGTCACTGACTGCCCCACCCCCTCCTTGCAGGTAAGGATGCCCCTACTCAACCCTCGGTGGGAAGAGGGAAGTGGGAAGATGCTCTGCTTGCTTCCTCGTTCATTTCTGTGAAGCAGAGTCCTCCAGGAAT

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

6

Interacting miRNAs (#binding sites)

mmu-miR-150-5p(1), mmu-miR-325-3p(1), mmu-miR-29b-2-5p(1), mmu-miR-369-3p(1), mmu-miR-532-5p(1), mmu-miR-296-3p(1)

siRNAs for circular RNA silencing
Junction sequence

CCCCTCCTTGCAGGTAAGGATGCCCC

siRNA sets

NA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.799961751

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page