top of page

mmu_ciMicu3_9292

Basic information of circular RNA
PanCircBase ID:

mmu_ciMicu3_9292

mm39_Chr. Position ID:

chr8|40819285|40828577|+

Gene name:

Micu3

Transcript:

ENSMUST00000068999.14

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

9

Exon/intron offsets:

0

Genomic length:

9292

Exon/intron sizes in nt:

9292

Flanking exon/introns:

chr8:40819285-40828577

Splice length:

9292

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTACAGTGAACCAGCCGTGCGGTCCTCGTACTCCTGTCGTTTGTTAATCTGATCTTCACTTGGTTTTAGAGTCACAAGAAGAAGCCCAAATGTAGTATTTTTCTATTTCTTTTAGCTTTTTTTAGTATAAAAGGAGTGTGGTGGCGGCTCAGCACTAAAGGCAGTATCTGTGTGCCCTCATTGCAGTGCCCCTGCAGCCGCCCATTCTGAAGGCCTTTTGTTTTCAGATAGATATAGATTCAATTTCAATAACAAATACATAAGGGTATGCCATGTTACAACCCTTTTTTCAATTGCCATTGAAAAGTTTTTGCCATCTAAGTCAACTCTTTAAACTTGACAAAATTAGAAAAACATGGTTAGAATATATGAATGTATGTATGTATGTATGTATGTATGTATGTATGTATGTATGTATGTATGTATGAAAATTTTTTCAATTGAAGGAAAAAATCTATCACCTGCTCCATCTTGGTAGCTTGCAGACGGGTACACTGGTTGTTCATGCTAACAGGCTAGTGGTGCCCATGCTTAAATCACCTTGAGCATGCCTCTGACATATCTGCCATACCCCAGTTACACTTAAGCTTGTTGAGGCAAAATCAACTGATATTTGCATCTCTGACTACAATAGTAGCGTGTGTACACTCTATTTATCTTCATATTGTAGCATTCTCCTACAAGTTATTATAGACAGGATTATTCCTGTCCTCAGATAAGGAAGCTGAATGTCCAGAAGGTCACTGAAGTCAAGACCTCAGATTTTAAATCCTGTCCTTTTCCCATTAGAAGGGTGTGCCTCACCCACCCAGTTCGTGGTGACATAGTGTCTTCCAGGGTTACTCTCTCCTCACATGGGACTCTGAAAGAAGGGTGGGTACCTCGCTCATCCTTCAACATTCATAATATGCTTTGTGAGCAAATATTTGTAAAGATAGTGTGTGATACTTGGCTACCTGTATTATTTTCTCCTCTAGCCAGCGGATGGGACTGCTGTCTGATCATTGCGGTGTGGGAATGTGGGCACGTGGCTTTTCTCGGGGACTCTGACCACTGAGGATGCGGTGGCTTGTCGGGGAATTTAAATGAGAACGAGTACCAGAGATCCCCCAGACTGTACAGAAACTATACTGGGGACCAGTAAGAAATCCACCCTCAATTACTTAATTATGAGCAGAACATTGGGATCATTCCTAAAGAATTTCAATAACTACCTTATTCTCTACAAGATAGGAGCTTAGGGCAGTTTTGTCTGGCTGCATTTGGGTTTGGGTTTTTTGTTTGTGTTTTGTTTGTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGAGATAGGGATTCATATATCATATAGCACCACTTAGCCTGGAACTTGAATTCTTGATTCTCCTGCCTCAGCCTCCCAAGTGCTGGGATTAAAGGCATGTGAAATCACATCTGGCTCAAAAGTCAAGTTTTTGATATAAATAATCCAAGTAGCATAGACCACTTTTTAAAAAGCAGCTAAAGATGGGCATCTAAGGGGAAATAGATGATCTACTACCTACAGCATTCTGATTCTTAGAAGAAAGTATTTGACCTGTGGAGGAAGAAAAAGAAGATCCTAATGTTACTAGAACAACTACCCTGTGAAAGACAGGGAAGAAGGCTTGGAGGAGTCTGTGTGTCTTGTAGATGATAAATGAAATGCACCTGCCACTAGACCCATCTTTTTTAGAACACCCTGCTTCAAGACTTCTGATAAGCACTTTCTCAGCTACACAACATCAGACAGACACAACCATTTATATTACTGTCAAAAATGGTGGCCCTGCGTTATCTTCTTACATTTCCTATGAGTTGTAATCACTTGAATTTCCTGAATTGTGTACTTGAATGTATGAAGTAGTTGTGAGCTGATGACAAAGGAAAGAAGAGGGGAAGACTAATGAAGCAGTAAAGTGGGAAGCTGCATAAGTAATTCCATCTGGTGAGGACTGCAACAGACACATTGGGATATGTTTATGGAAATGTAGCTTATTAAGTTGAGTAAAGAAGAGAAAATCCGGACAAAAGCCCCTTCTGCTCCACTCCAGCCCAGGGCTTCCTGGCCAGCGGAGTTGCCTGACACCCGCAAGGGCCCACACAAGATTTCCCACGGGATCCTAAGACCTCTGGTGAGTGGAACACAGCGCCGGCCCCAATCCAATCGCGCGGAACCTGAGACTGCGGTACATAGGGAAGCAGACTGCCCGGGCCTGACCCGGGGCAAAAGCCCCTTCCGCTCCACTCGAGCCCCGGGCTTCCTTGCCAGCAGAGTCACCTGACACCCGCAAGGGCCCACACAGGATTCCCCACGGGATCCTAAGACTGCTGGTGAGTGGAACACAGCGCCGGCCCCAATCCAATCTCGCGGACCTGAGACTGCGGTACATAGGGAAGCAGACTGCCCGGGCCTGACCCGGGGCAAAAGCCCCTTCCGCTCCACTCGAGCCCCGGGCTTCCTTGCCAGCAGAGTCGCCTGACACCCGCAAGGGCCCACACAGGATTCCCCACGGGATCCTAAGACCTCTAGTGAGTGGAACACAACTTCAGCCAGGAGTCCTGTTCGAACACCAGATATCTGGGTACCTTCCCTGCAAGAAGAGAGCTTTCCTGCAGAGAATACTCTACCCACTGAAACCAAGGAGAGTGCTACCCTCCCAGGTCTGCTTATAGAGGCTAACAGAGTCACCTGAAGTACAAACTCTTAACAGAGACAACTATAACAGCTGGCTTCAGAGATTACCAGATGGCGAAAGGCAAACGTAAGAATCCTACTAACAGAAATCAAGACCACTCACCATCATCAGAACGCAGCACTCCCACCCCACCTAGCCCTGGGCACCCCAACACAACCGAAAATCTAGACCCAGATTTAAAAGCATTTTTCATGATGATGATAGAGGACATCAAGAAGGACTTTCATAAGTCACTTAAAGAATTACAGGAGAGCACTGCTACAGAGTTACAGGCCCTTAAAGAAAAGCAGGAAAACACAGCCAAACAGGTAGAAGACCTTAAAGAAAAACAGGAAAACACATCCAAACAGGTAATGGAAATGAACAAAACCATACTAGAACTAAAAAGGGAAGTAGACACAGTAAAGAAAACCCAAAGCGAGGCAACGCTGGAGATAGAAACCCTAGGAAAGAGATCTGGAACCATAGATGCGAGCATCAGCAACAGAATACAAGAAATGGAAGAGAGAATCTCAGGTGCAGAAGATTCCATAGAGAACATCGACACAACAGTCAAAGAAAATACAAAATGCAAAAGGATCCTAACTCAAAACATCCAGGAAATCCAGGACACAATGAGAAGACCAAACCTACGCATAATAGGAGTGGATGAGAAGGAAGATTTTCAACTCAAAGGACCAGCAAACATCTTCAACAAAATAATTGAAGAAAACTTCCCAAACATAAAGAGATGCCCATGATCATACAAGAAGCCTACAGAACTCCAAATAGACTGGACCAGAAAAGAAATTCCTCCCGACACATAATAATCAGAACAACAAATGCACTAAATAAAGATAGAATATTAAAAGCAGTAAGGGAGAAAGGTCAAGTAACATATAAAGGAAGGCCTATCAGAATTACACCAGACTTTTCACCAGAGACTATGAAAGCCAGAAGAGCCTGGACAGATGTTATACAGACACTAAGAGAACACAAATGCCAGCCCAGGCTACTATACCCGGCCAAACTCTCAATTACCATAGATGGAGAAAGCAAAGTATTCCACGACAAAACCAAATTCACACAATATCTTTCCACGAATCCAGCCCTTCAAAGGATAATAACAGAAAAGAAGCAATACAAGGACGGAAATCACGCCCTAGAACAACCAAGAAAGTAATCATTCAACAAACCAAAAAGAAGACAGCCACAAGAACAGAATGCCAACTCTAACAACAAAAATAAAAGGAAGCAACAATTACTTTTCCTTAATATCTCTTAATATTAATGGACTCAATTCCCCAATAAAAAGACATAGACTAACAGACTGGCTACACAAACAGGACCCAACATTCTGCTGCTTACAGGAAACCCATCTCAGGGAAAAAGACAGACACTACCTCAGAGTGAAAGGCTGGAAAACAATTTTCCAAGCAAATGGTCTGAAGAAACAAGCTGGAGTAGCCATTCTAATATCGGATAAAATCGACCTCCAACCCAAAGTTATCAAAAAAGACAAGGAGGGACACTTCATACTCATCAAAGGTAAAATCCTCCAAGAGGAACTCTCAATTCTGAATATCTATGCTCCAAATGCAAGAGCACCCACATTCATTAAAGACATTTTAGTAAAGCTCAAAGCACACATTGCACCTCACACAATAATAGTGGGAGACTTCAACACACCACTTTCATCAAGGGACAGATCGTGGAAACAGAAACTAAACAGGGACACAGTGAAACTAACAGAAGTTATGAAACAAATGGACCTAACAGATATCTACAGAACATTTTATCCTAAAACAAAAGGATATACCTTCTTCTCAGCACCTCATGGGACCTTCTCCAAAATTGACCATATAATTGGTCACAAAACAGGCCTCAACAGATACAAAAATATTGAAATTGTCCCATGTATCTTATCAGACCACCATGGCCTAAGACTGATCTTCAATAACAACATAAATAATGGAAAGCCAACATTCATGTAAAAACTGAACAACACTCTTCTCAATGATACCTTGGGCAAGGAAGGAATAAAGAAAGAAATTAAAGACTTTTTAGAGTTTAATGAAAATGAAGCCACAACGTACCCAAACCTTTGGGACACAATGAAAGCATTTCTAAGAGGGAAACTCATAGCTCTGAGTGCCTCCAAGAAGAAACGGGAGAGAGCACATACTAGCAGCTTGACAACACATCTAAAAGCTCTAGAAAAAAAGGAAGCAAATTCACCCAAGAGGAGTAGACAGCAGGAAATAATCAAACTCAGGGGTGAAATCAACCAAGTGGAAGAATTAACCAAACGAGGAGTTGGTTCTTTGAGAAAATCAACAAGATAGATAAACCCTTAGCTAGACTTACTAAAGGGCACATGGACAAAATCCTAATTAACAAAATCAGAAATGAAAAGGGAGACATAACAACAGATCCTGAAGAAATCCAAAACACCATCAGATCCTTCTACAAAAGGTTATACTTAACAAAACTGGAAAACCTGGACGAAATGGACAAATTTCTGGACAGATACCAGGTACCAAAGTTGAGTCAGGATGAAGTTGACCATCTAAACAGTCCCATATCACCTAAAGAAATAGAAGCAGTTATTAATAGTCTCCCAGCCAAAAAAAGCCCAGGACCAGACGGGTTTAGTGCAGAGTTCTATCAGACCTTCAAAGAAGATCTAATTCCAGTTCTGCACAAACTATTTCACAAAATAGAAGTAGAAGGTACTCTACCCAACTCATTTTATGAAGCCACTATTACTCTGATACCTAAACCACAGAAAGATTCAACAAAGATAGAGAACTTCAGACCAATTTCTCTTATGAATATCGATGCAAAAATCCTCAATAAAATTCTTGCTAACCGAATCCAAGAACATATTAAAGCAATCATCCATCCTGACCAAGTAGGTTTTATTCCAGGAATGCAGGGATGGTTTAATATACGAAAATCCATCAATGTAATCCATTATATAAACAAACTCAAAGACAAAAACCATATGATCATCTTGTTAGATGCAGAAAAAGCATTTGACAAGATTCAACACCCATTCATGATTAAAGTTTTGGAATTTCAGGAATTCAAGGCCCATACCTAAACATGATAAAAGCAATCTACAGCAAACCAGTAGCCAACATCAAAGTAAATGGAGAGAAGCTGGAAGCAATCCCACTAAAATCAGGGACTAGACAAGGCTGCCCACTTTCTCCCTACCTTTTCAACATAGTACTTGAAGTATTAGCCAGAGCAATTCGACAACAAAAGGAGATCAAGGGGATACAAATTGGAAAAGAGGAAGTCAAAATATCACTTTTTGCAGATGATATGATAGTATATATAAGTGACCCTAAAAATTCTACCAGAGAACTCCTAAACCTGATAAACAGCTTCGGTGAAGTAGCTGGATATAAAATAAACTCAAACAAGTCAATGGCCTTTCTCTATACAAAGAATAAACAGGCTGAGAAAGAAATTAGGGAAACAACACCCTTCTCAATAGTCACAAATAGTATAAAATATCTTGGCGTAACTCTAACTAAGGAGGTGAAAGATCTGTATGATAAAAACTTCAAATCTCTGAAGAAAGAAATTAAAGATCTCAGAAGATGGAAAGATCTCCCATGCTCATGGATTGGCAGGATCAACATTGTAAAAATGGCTATCTTGCCAAAAGCAATCTACAGATTCAATGTAATCCCCATCAAAATTCCAACTCAATTCTTCAACGAATTAGAAGGAGCAATTTGCAAATTCATCTGGAATAACAAAAAACCTAGGATAGCAAAAACTCTTCTCAAGGATAAAAGAACCTCTGGTGGAATCACCATGCCTGACCTAAAGCTTTACTACAGAGCAATTGTGATAAAAACTGCATGGTACTGGTATAGAAACAGACAAGTAAACCAATGGAATAGAATTGAAGACCCAGAAATGAACCCACACACCTATGGTCACTTGATCTTCGACAAGGGAGCTAAAACCATCCAGTTGAAGAAAGACAGCATTTTCAACAATTGGTGCTGGCACAACTGGTTGTTATCATGTAGAAGAATGCGAATCGATCCATACTTATCTCCTTGTACTAAGGTCAAATCTAAGTGGATCAAAGAACTTCACATAAAACCAGAGACACTGAAACTTATAGAGGAGAAAGTGGGGAAAAGCCTTGAAGATATGGGCACAGGGGAAAAATTCCTGAACAGAACAGCAATGGCATGTGCTGTAAGATCGAAAATTGACAAATGGGACCTAATGAAACTCCAAAGTTTCTGCAAGGCAAAAGACACCGTCAACAAGACAAAAAGACCACCAACAGATTGGGAAAGGATCTTTACCTATCCTAAATCAGATAGGGGCTAATATCCAACATATATAAAGAACTCAAGAAGGTGGACTTCAGAAAATCAAACAACCCCATTAAAAAATGGGGCTCAGAACTGAACAAAGAATTCTCACCTGAGGAATACCGAATGGCAGAGAAGCACCTGAAAAAATGTTCAACATCCTTAATCATCAGGGAAATGCAAATCAAAACAACCCTGAGATTCCACCTCACACCAGTCAGAATGGCTAAGATCAAAAATTCAGGTGACAGCAGATGCTGGCAAGGATGTGGAGAAAGAGGAACACTCCTCCATTGTTGGTGGGATTGCAGGCTTGTACAACCACTCTGGAAATCAGTCTGGCGGTTCCTCAGAAAATTGGACATAGTACTACCGGAGGATCCAGCAATACCTCTCCTGGGCATTTATCCAGAAGATGCCCCAACTGGTAAGAAGGACACATGCTCCACTATGTTCATAGCAGCCTTATTTATAATAGCCAGAAGCTGGAAAGAACCCAGATGCCCCTCAACAGAGGAATGGATACAGAAAATGTGGTACATCTACACAATGGAGTACTACTCAGCTATTAAAAAGAATGAATTTATGAAATTCCTAGCCAAATGGATGGACCTGGAGGGCATCATCCTGAGTGAGGTAACACATTCACAAAGGAACTCACACAATATGTACTCACTGATAAGTGGATATTAGCCCCAAACCTAGGATTCCCAAGATATAAGGTACAATTTGCTAAACACATGAAACTCAAGAAGAATGAAGACTGAAGTGCGGACACTATGCCCCTCCTTAGAATTGGGAACAAAACACCCATGGAAGGAGTTACAGAGACAAAGTTTGGAGCTGAGATGAAAGGTTGGACCATGTAGAGACTGCCATATCCAGGGATCCACCCCATAATCAGCATCCAAAAGCTGACACCATTGCATACCCTAGCAAGATTTTATTGAAAGGACCCAGATGTAGCTATCTCTTGTGAGACTATGCCGGGGCCTAGCAAACACAGAAGTGGATGCTCACAGTCAGCTAATGGATGGATCAAAGGCTCCCAATGGAGGAGCTAGAGAAAGAACCCAAGGAGCTAAAGGGATCTGCAACCCTATAGGTGGAACAACATTATGAACTAACCAGTACCCCCCGGAGCTCTTGACTCTAGCTGCATATGTAACAAAAGATGGCCTAATCGGCCATCACTGGAAAGAGAGGCCCATTGGACACGCAAACTTTATATGCATACAGGGGAACGCCAGGGCCAAAAAGGGGGAGTGGGTGGGTAGGGGAGTGGGGGTGGGTGGGTATGGGGGACTTTTGGTATAGCATTGGAAATGTAAATGAGCTAAATACCTAATAAAAAATGGAAAAATAAATAAATAAATTCCACTGCAAATAGTAAAAAAAAAAAAAAAAAGAAGAGAAAATCCTGTGGAATAACTTCCTGAACATTCAAAAATTATATGATGCTTATCTTTGACAAAAAGTACCAGTGATAAATTACTACTGTAGTTCATTTTTCTAAACACATTATCACATATTTTAAAATTGGTTGTAATATAATAAGTGTGGTTAAGGAAAGCTTCAGCTCATTCCCTGTCCTTCCCATAGAGTCAGTCAGTGCTTCGGGGAAAGCTCTCTCAGCTGAATTGTTCAGACTGTTTAGGAAATAGAAACTAATCACTTAGGTAAAAGTGGCAGAATTAAATGATGTCTAAATAACTACTTGATACAGTCAATAGGATAGGTTCCCTATATTCATCATAATTTTAGGTAGAATACTTTTAAACTATAACTGATGAACATTTTCAACAATAAAAATCAGTATTGCTCAAGTTTCTATTTTAAAATTTGAATATTTTAGTTATAGTTCCATCTATGATTATAGTCTTTGCTCTTCATTCTGATGCTTGTGCCTTTTCGTGCTTGGATTTGTTTTACACATAAAAGTGTTTCGCCTGCATATGTATATGCATACCATGTATGTGCCTATGCATGTGGAGATGAGGAGGAATAGGAGATGCCCTGGACCTGGAGGTGTGGGTGGTTTGGAGCCATCATGTGGATGCTGGGAACCAAAGCTGGGTCCTCGAGAACAGCAGGAAGTGCTCTTAAACAGCGATCCACCTCTCCAGCCTTTCCTGACTTATATTTTGATAAAGTTCTTGGAAGAATATTTAGTATGCTGTCTTGTTTTGGGCTTGTTTGGTTGGTATTTTGTTGCTAATTTTAAATTATGTTTTTAAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

TGCTGTCTTGTTTTGGGCTTG

59.86

TGGGCTTCTTCTTGTGACTCT

58.95

152

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

GCTGTCTTGTTTTGGGCTTGT

59.86

TGGGCTTCTTCTTGTGACTCT

58.95

151

PCR template sequence:

TATATTTTGATAAAGTTCTTGGAAGAATATTTAGTATGCTGTCTTGTTTTGGGCTTGTTTGGTTGGTATTTTGTTGCTAATTTTAAATTATGTTTTTAAGGTACAGTGAACCAGCCGTGCGGTCCTCGTACTCCTGTCGTTTGTTAATCTGATCTTCACTTGGTTTTAGAGTCACAAGAAGAAGCCCAAATGTAGTATTT

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

73

Interacting miRNAs (#binding sites)

mmu-miR-136-5p(4), mmu-miR-466d-3p(4), mmu-miR-9-5p(3), mmu-miR-211-5p(3), mmu-miR-204-5p(3), mmu-miR-196a-5p(3), mmu-miR-29b-1-5p(3), mmu-miR-1198-5p(3), mmu-miR-466b-3p(3), mmu-let-7a-5p(2), mmu-let-7b-5p(2), mmu-miR-26a-5p(2), mmu-let-7c-5p(2), mmu-miR-181b-5p(2), mmu-miR-153-3p(2), mmu-miR-125b-1-3p(2), mmu-miR-680(2), mmu-miR-29b-2-5p(2), mmu-miR-335-3p(2), mmu-miR-452-3p(2), mmu-miR-670-5p(2), mmu-miR-1904(2), mmu-miR-181d-5p(2), mmu-miR-124-3p(1), mmu-miR-20b-5p(1), mmu-miR-140-5p(1), mmu-miR-16-5p(1), mmu-miR-15a-5p(1), mmu-miR-106a-5p(1), mmu-miR-93-5p(1), mmu-miR-20a-5p(1), mmu-miR-17-5p(1), mmu-miR-429-3p(1), mmu-miR-200b-3p(1), mmu-miR-135a-5p(1), mmu-miR-31-5p(1), mmu-miR-15b-5p(1), mmu-miR-106b-5p(1), mmu-miR-29b-3p(1), mmu-miR-335-5p(1), mmu-miR-29c-3p(1), mmu-miR-328-3p(1), mmu-miR-298-5p(1), mmu-miR-222-3p(1), mmu-miR-132-3p(1), mmu-miR-709(1), mmu-miR-125b-5p(1), mmu-miR-339-5p(1), mmu-miR-434-3p(1), mmu-miR-351-5p(1), mmu-miR-26b-5p(1), mmu-miR-125a-5p(1), mmu-miR-199b-3p(1), mmu-miR-182-5p(1), mmu-miR-199a-3p(1), mmu-miR-511-3p(1), mmu-miR-342-5p(1), mmu-miR-98-5p(1), mmu-miR-1187(1), mmu-miR-190b-5p(1), mmu-miR-129-5p(1), mmu-miR-207(1), mmu-miR-5101(1), mmu-miR-369-3p(1), mmu-miR-539-5p(1), mmu-miR-532-5p(1), mmu-miR-669d-5p(1), mmu-miR-188-3p(1), mmu-miR-3065-5p(1), mmu-miR-350-3p(1), mmu-miR-202-3p(1), mmu-miR-338-3p(1), mmu-miR-7a-1-3p(1)

siRNAs for circular RNA silencing
Junction sequence

TTATGTTTTTAAGGTACAGTGAACCA

siRNA sets

TCACTGTACCTTAAAAACA, TTCACTGTACCTTAAAAAC

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.682377362

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page