top of page

mmu_ciGmfb_1157

Basic information of circular RNA
PanCircBase ID:

mmu_ciGmfb_1157

mm39_Chr. Position ID:

chr14|47053685|47054842|-

Gene name:

Gmfb

Transcript:

ENSMUST00000079314.12

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

2

Exon/intron offsets:

0

Genomic length:

1157

Exon/intron sizes in nt:

1157

Flanking exon/introns:

chr14:47053684-47054842

Splice length:

1157

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTAAGCTGAAGTTGCCTCAAAACTATATGATGTTAGTTTGTTTTCTCTTAAAGCTCCTTTGAATACTCCAAGCCTTCAGAGTGCAATGGTGCCTCCACCGGCTGCATTTACCACCGTTACCTCTGCAAGTTAAACTGCTCATGCCATTGCCAAAGATAACCCTGAGCCAGCTGCCTCCCCAGCTCTGGAGAGGCCGATTGTCTTAGTCACTTGAGGAGTGAGGGTTCCCATTGTAGTGACCCATGGACTTTGTCTTTCCCAGGGTGCTAACAGTAGTTCAGACCAAACATTTGCCCACACCTAAATTGTAAAGTTCAGCACTGGGCATTGATCTTAGTTGTGGAAGGACTTTACTTGTTTTGTAGGTAATACTTTGTGGGCAATGATTTAGAAAAGGGCTGAGGCAGTGAAGACATAAAGAGCATAGGCCACTTGTCAGAGGTGCATCAGGCAGGTGTCAGTAAACCAGCTGGTGGCACCTTAGCAAGTTTGTCTGTTATAACTAAATGCTATCATGTGGTCATTTGGTTCTTAAAGGGAAAATGTGGAAGAGTGGCATTTACCACCAAAGATGAGGCCATGTGAAGTCACATTGTGTGTTCGTAGGATTTAATGTGAATTTTGTGCAAACCCGAACATAGTTGCATCATTAGACAGGTAGAAAAGTATAAAGGCATAGGCGACCTTTATTTTCACATAGATTTGGGTTGGGTTATATCACTTATATTTGAATATCTTTGAATAGAGGTGGGATTGGTAATTCACTTTCTCAGAATAATGACTATATGCATGGCATTGTAATGTTGGCGAAGCTGGAGGTCTTGGGGTTCTCTCTCCTGACCCCTGGTGAGCACTTCTTTTGCAGTTCTAATGTTGCACATAGACCAAGCTCAGGGTTATCCTTCCCAGCCCCTTAGAAAGTTGCATTGGGTTAGGAAGTTCTCCATACCCGAAGTCCATGTGAGGAGCTGGTAAGAGTCTAAATAATAAACAAGCAAGTTCCATGCTGGGAGTTCTATCCACAAGTGTAAAGGCAAAACTTGAATGTGCTTTATGCTGTTTCTTGGTGCTGTAGTTTGAGGTGCTCCCTCCCCTCCGCAATGACTAGGGCTGCACTGGGTTGGGTGACACGTTACTTACACTGTATTTTCATTGTA

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

AATGACTAGGGCTGCACTGG

59.75

TGCACTCTGAAGGCTTGGAG

59.96

143

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

AATGACTAGGGCTGCACTGG

59.75

GCACTCTGAAGGCTTGGAGT

59.96

142

PCR template sequence:

TGTTTCTTGGTGCTGTAGTTTGAGGTGCTCCCTCCCCTCCGCAATGACTAGGGCTGCACTGGGTTGGGTGACACGTTACTTACACTGTATTTTCATTGTAGTAAGCTGAAGTTGCCTCAAAACTATATGATGTTAGTTTGTTTTCTCTTAAAGCTCCTTTGAATACTCCAAGCCTTCAGAGTGCAATGGTGCCTCCACCG

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

14

Interacting miRNAs (#binding sites)

mmu-miR-204-5p(1), mmu-miR-29b-3p(1), mmu-miR-130a-3p(1), mmu-miR-18a-5p(1), mmu-miR-149-5p(1), mmu-miR-501-3p(1), mmu-miR-182-5p(1), mmu-miR-324-3p(1), mmu-miR-344d-3p(1), mmu-miR-3470b(1), mmu-miR-323-3p(1), mmu-miR-339-3p(1), mmu-miR-181d-5p(1), mmu-miR-7a-2-3p(1)

siRNAs for circular RNA silencing
Junction sequence

TATTTTCATTGTAGTAAGCTGAAGTT

siRNA sets

CTTCAGCTTACTACAATGA, TTCAGCTTACTACAATGAA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.72473267

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page