top of page

mmu_ciG6pc2_525

Basic information of circular RNA
PanCircBase ID:

mmu_ciG6pc2_525

mm39_Chr. Position ID:

chr2|69050594|69051119|+

Gene name:

G6pc2

Transcript:

ENSMUST00000005364.12

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

1

Exon/intron offsets:

0

Genomic length:

525

Exon/intron sizes in nt:

525

Flanking exon/introns:

chr2:69050594-69051126

Splice length:

525

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTAAGACTTCTGTTTTATCTTTCCTGAAATTTATCCTTAAATTTGTAATCTTAGCTTAGTGATCACGTTTCAGGTGCATGTACTTCGACACAGAAATCTTCCAAACAAGCTGGTTACCTTGAAACACCAGATTCATAAGTAGAACTAACAGAAAGCATAGAAATATATACTTTGAATTACAAGTGATTTCACACTTAACACATATGCTATCATTAACCAAGAAGTTAGCAGTACAATAATGAGATTGATGTTTCTAAGTTCCATTTTGATAATTCCAAACGAAGTACCCAAAGCATCCACAGGACTTCCCTGGTTATGGGAGACAAGTATTTCCAAACCCCAGATACTACCATGCTCTTTCATGATGAGAGACCAGGACTCAAGTTATTTAAGGGTGTTTTAATTATGAGTTTTCACCCTTGACTCTTTACTTGAGGTGCGTGTTTTTTTTTTTTAAACAAGAATTGTGAGTCTCCACTTAGCCAGCTGTTGTATTTAAGTACATATGAAATTCATATTTGTTTA

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

GTCTCCACTTAGCCAGCTGT

59.39

TGTGTCGAAGTACATGCACCT

59.66

147

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

TCCACTTAGCCAGCTGTTGT

59.24

TGTGTCGAAGTACATGCACCT

59.66

144

PCR template sequence:

CTTTACTTGAGGTGCGTGTTTTTTTTTTTTAAACAAGAATTGTGAGTCTCCACTTAGCCAGCTGTTGTATTTAAGTACATATGAAATTCATATTTGTTTAGTAAGACTTCTGTTTTATCTTTCCTGAAATTTATCCTTAAATTTGTAATCTTAGCTTAGTGATCACGTTTCAGGTGCATGTACTTCGACACAGAAATCTT

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

1

Interacting miRNAs (#binding sites)

mmu-miR-224-5p(1)

siRNAs for circular RNA silencing
Junction sequence

TCATATTTGTTTAGTAAGACTTCTGT

siRNA sets

ACAGAAGTCTTACTAAACA, TCTTACTAAACAAATATGA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.950784208

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page