top of page

mmu_ciDnajb2_1254

Basic information of circular RNA
PanCircBase ID:

mmu_ciDnajb2_1254

mm39_Chr. Position ID:

chr1|75216274|75217528|+

Gene name:

Dnajb2

Transcript:

ENSMUST00000188931.7

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

5

Exon/intron offsets:

0

Genomic length:

1254

Exon/intron sizes in nt:

1254

Flanking exon/introns:

chr1:75216274-75217535

Splice length:

1254

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTACGTAGACGCAGGGTTGCTCCACTCCCTCTTCCAGCCTGCTGTCTGTCCTCTGTGGGGAATCTCTCAGGCTAGAGCCGGAGACGGAATTGGAATTTCACAGCCGGGAGATTTGAGGTTGTAGGCGTGAGTCCAGGGAAAGCTAGGACAGAACCTGACACATGGCAGGACTCACGTGACACACCAGTGACACTTCACAGACTGGCCTTATTAAATGACAACAAGAACACATTGTTAAGCCTCCACAACAGCCACCAGTGGAGCAAGACTCAAAAGCATCATGTGACTGCTGCAGCGCCATTACACATAACAACAGACACCTTTTTTTGTTGTGGTTTGATGACTAACATATGCCAAGAGTTCTACATCTCCTAAAGCCTCTTGTAAATCCTGAGAGCTGAGCCATTTTAATCCCCATTTCCAGATGAGAAGACGGAAGCATGTTAGTTAGCTTAGATGCGCACAAGTAATTGGCACAGCTGGGTGGCTAGGAAGGCGCTCTGTGGTAGGGGCTTGTCCAGCATGTGCAGGGCACTGATTTCAGTCCCCGGCACCACAAATCAAAACGTGAAGGCAAATCTGTTGATTAAAAGACTCCTTCGACAAGCATGGTTTGCACATGCCTGTAAAGAACTCACCACTGAGCACTGGCCACGGTGGTGCACACTTTTAATCCCTGCGCTCAGGAGGCAGAGGCACTCTTGAGTTCAGGGCTAGCCTGCTCTACCTAGCAATTTTCAGGCCAGCCAGACCTATGCAGTGAGAACCTGTCTCAAAACCCCAAAAGAACTTTAAACTTGGGAGATGGAGGCCCAAGATCAGGGCTTCAGGGTCATCTTTATCTATTAAGTTTGAGGCTAGCCTGAGCTACTGATACTGAGACGCTTTTTCCAAAAAAAAAAAAAAAAAAAAAAACAGTTTAAAAAATGTGTAAGTGGGGCTGGAGAGATGGCTCAGCGGTTAAGAGATTTTGAGTTCAATTCCCAGCAACCACATGGTGGCTCACAACCATCTGTGATGGGATCTGATGCCCTCTTCTGGTGTGTCTGAAGACAGGGACAGTGTACTCATATATACAGAATAAATAAATATATTAAAAAAAACAACAATAATCTTAAAACATTTTGTAAGTTTACACAACCCCAAACAGGAGCCATCAGAAGTGTATCGGGTTGTTTAGCAGCTTGCTTTCTAGGCCTTAAGGCTACAGCCACACACATTTTGGAGGAAAGCTCTTCACCAAGGACTTACCTT

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

CGGGTTGTTTAGCAGCTTGC

60.39

CACAGAGGACAGACAGCAGG

60.04

143

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

CGGGTTGTTTAGCAGCTTGC

60.39

CCACAGAGGACAGACAGCAG

60.04

144

PCR template sequence:

CATCAGAAGTGTATCGGGTTGTTTAGCAGCTTGCTTTCTAGGCCTTAAGGCTACAGCCACACACATTTTGGAGGAAAGCTCTTCACCAAGGACTTACCTTGTACGTAGACGCAGGGTTGCTCCACTCCCTCTTCCAGCCTGCTGTCTGTCCTCTGTGGGGAATCTCTCAGGCTAGAGCCGGAGACGGAATTGGAATTTCA

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

13

Interacting miRNAs (#binding sites)

mmu-miR-19b-3p(1), mmu-miR-19a-3p(1), mmu-miR-217-5p(1), mmu-miR-125b-5p(1), mmu-miR-339-5p(1), mmu-miR-214-3p(1), mmu-miR-24-3p(1), mmu-miR-541-5p(1), mmu-miR-466a-5p(1), mmu-miR-1187(1), mmu-miR-1198-5p(1), mmu-miR-466p-5p(1), mmu-miR-339-3p(1)

siRNAs for circular RNA silencing
Junction sequence

AAGGACTTACCTTGTACGTAGACGCA

siRNA sets

TCTACGTACAAGGTAAGTC,CTACGTACAAGGTAAGTCC,TACGTACAAGGTAAGTCCT

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.644152786

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page