top of page

mmu_ci2410006H16Rik_126

Basic information of circular RNA
PanCircBase ID:

mmu_ci2410006H16Rik_126

mm39_Chr. Position ID:

chr11|62493849|62493975|+

Gene name:

2410006H16Rik

Transcript:

ENSMUST00000131787.2

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

1

Exon/intron offsets:

0

Genomic length:

126

Exon/intron sizes in nt:

126

Flanking exon/introns:

chr11:62493849-62494060

Splice length:

126

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTAAGTCGAGGTCTGCATCGCGGGGCGCCGCGCGTGGGCGGGGTGTCGGCTGCAATGATGATGAAACTAGAAAAAAAAGGAAGTGCCGTCCGATGCGACAACTGACGACATCCCTAGTTAGCTGAC

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

NA

NA

NA

NA

NA

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

NA

NA

NA

NA

NA

PCR template sequence:

AAACTAGAAAAAAAAGGAAGTGCCGTCCGATGCGACAACTGACGACATCCCTAGTTAGCTGACGTAAGTCGAGGTCTGCATCGCGGGGCGCCGCGCGTGGGCGGGGTGTCGGCTGCAATGATGATG

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

1

Interacting miRNAs (#binding sites)

mmu-miR-223-3p(1)

siRNAs for circular RNA silencing
Junction sequence

CTAGTTAGCTGACGTAAGTCGAGGTC

siRNA sets

NA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.156947095

IRES/non IRES

non-IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page