top of page

mmu_circBtbd7_1867

Basic information of circular RNA
PanCircBase ID:

mmu_circBtbd7_1867

mm39_Chr. Position ID:

chr12|102774158|102807450|-

Gene name:

Btbd7

Transcript:

ENSMUST00000223554.2

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

6

Exon/intron indexes:

7,6,5,4,3,2

Exon/intron offsets:

0,3220,4735,29718,32200,33139

Genomic length:

33292

Exon/intron sizes in nt:

1,61,76,20,91,08,01,88,000

Flanking exon/introns:

chr12:102761575-102774158|chr12:102807450-102844474

Splice length:

1867

Other database IDs:

CIRCpedia: MMU_CIRCpedia_777, circAtlas: mmu-Btbd7_0017

Human Ortholog IDs:
Mature spliced Sequence:

GGTTTATGGGAAAGATAAACTAAAGCGTTGTTTTTGACTGGGCCTGATGATGCAAGCCTGTTATCCCAGCTCCTTAGGAGGCAGAGGCAGGAAGATGGCAAGTTCAAGGGCAGCCTGAATAACAGCCATACCGTGTCTCAAAGTTTTTAAAAGAAATGGATGAAAAGAGGCTACTGGATCCAGGGTTGAAGGTTCGTAAAGGCCTCTGGGATTACCCTCTGAAGAACCAGCAGATGGAATGCCGGAGTGACTGAAAAAAATGGGTGCTAATGCATCTAACTATCCTCATTCATGTTCCCCAAGGGTAGGGGGAAATTCACAGGCCCAGCAGACTTTCATAGGAACATCTTCCTATTCTCAACAAGGCTATGGTTGTGAGTCAAAGTTGTATAGCCTTGACCATGGCCATGAGAAACCACAAGACAAAAAAAAGAGAACCTCTGGCCTTGCCACTCTCAAAAAGAAGTTTATTAAACGCCGAAAATCTAATAGATCGGCTGATCACGCCAAGCAGATGCGAGAACTCCTCTCTGGGTGGGATGTTAGAGATGTCAATGCACTAGTGGAAGAATATGAGGGAACTTCAGCCTTGAAGGAGCTTTCTCTGCAAGCCAGTTTGGCTAGGCCAGAAGCTCGGACCCTGCAGAAGGACATGGCCGACCTTTATGAGGATAAGTACTGTACTGACGTGGACTTAATATTTCAGGAAACTTGTTTTCCTGTTCACCGTGCCATTTTGGCAGCAAGGTGTCCATTTTTTAAAACCCTGCTTTCTTCTTCACCTGAGTATGGGGCAGAGATAATAATGGACATCAGTACAGCTGGTATTGATATGCCCATGTTTTCCGCCTTGTTACACTACCTTTATACAGGAGAGTTTGGAATGGAGGACTCAAGATTTCAGAATGTCGACATCCTTGTTCAGCTTAGTGAAGAATTTGGAACACCAAATCCCCTTGATGTAGATATGCGTGGACTCTTTGATTACATGTGTTATTATGATGTTGTCCTTAGTTTTTCTTCAGATTCTGAACTAGTTGAAGCTTTTGGTGGAAATCAGAACTGTTTAGATGAAGAGCTCAAAGCCCACAAGGCTATTATTTCTGCACGGTCCCCGTTTTTCCGAAATTTATTACAAAGGAGAATACGGACTGGTGAAGAAATCACAGACCGAACTTTGAGAACTCCCACAAGAATTATATTAGATGAGTCCATTATACCAAAAAAATATGCAAAAGTGATATTACACTGTATGTATACCGATGTGGTGGACCTCTCTGTTTTACACTGTAGCCCCTCTGTGGGGAGTCTCAGTGAAGTTCAGGCTCTCGTCGCAGGGAAGCCAAACATGACCAGGGCAGAAGAAGCCATGGAACTTTACCACATAGCACTATTCTTGGAATTTAACATGCTTGCACAAGGCTGTGAGGACATCATTGCTGAGAGCATCTCATTAGACACCTTAATTGCCGTCCTCAAGTGGAGCTCGCATCCATACGGCTCTAAGTGGGTGCACCGACAAGCTGTGCATTTCCTGTGTGAGGAGCTATCCCAGGTCATGACTTCGGATGTTTTTTATGAACTGAGCAAAGACCATCTGCTTACTGCTATCCAGTCTGACTACCTACAGGCAAGCGAACAAGATATCCTTAAATATCTGATTAAATGGGGTGAGCATCAGTTGATGAAAAGAATAGCAGACAGAGAGCCAAACTTACTGAGTGGCACTGCACATAGTGTGAACAAAAGAGGTGTGAAGAGAAGAGACCTGGACATAGAAGAACTTAGAGAGATCCTTTCTTCTCTCTTGCCTTTTGTGCGGATTGAACACATCCTACCTATAAACAGTGAGGTCTTAAGTGATGCA

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

TCTCTTGCCTTTTGTGCGGA

60.18

CATCTTCCTGCCTCTGCCTC

60.18

161

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

CTCTCTTGCCTTTTGTGCGG

59.76

CATCTTCCTGCCTCTGCCTC

60.18

162

PCR template sequence:

CCTGGACATAGAAGAACTTAGAGAGATCCTTTCTTCTCTCTTGCCTTTTGTGCGGATTGAACACATCCTACCTATAAACAGTGAGGTCTTAAGTGATGCAGGTTTATGGGAAAGATAAACTAAAGCGTTGTTTTTGACTGGGCCTGATGATGCAAGCCTGTTATCCCAGCTCCTTAGGAGGCAGAGGCAGGAAGATGGCA

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

17

Interacting miRNAs (#binding sites)

mmu-miR-335-3p(2), mmu-let-7a-5p(1), mmu-miR-375-3p(1), mmu-miR-135a-5p(1), mmu-let-7c-5p(1), mmu-miR-101b-3p(1), mmu-miR-203-3p(1), mmu-let-7d-5p(1), mmu-miR-24-3p(1), mmu-miR-136-5p(1), mmu-miR-183-5p(1), mmu-miR-466d-3p(1), mmu-miR-690(1), mmu-miR-29b-2-5p(1), mmu-miR-342-3p(1), mmu-miR-673-5p(1), mmu-miR-669d-5p(1)

siRNAs for circular RNA silencing
Junction sequence

CTTAAGTGATGCAGGTTTATGGGAAA

siRNA sets

TTTCCCATAAACCTGCATC, TTCCCATAAACCTGCATCA, TAAACCTGCATCACTTAAG

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCBTBD7_1867_ORF_1

0.849

0.063477856

0.999736646

1626

ORF sequence:

ATGGGTGCTAATGCATCTAACTATCCTCATTCATGTTCCCCAAGGGTAGGGGGAAATTCACAGGCCCAGCAGACTTTCATAGGAACATCTTCCTATTCTCAACAAGGCTATGGTTGTGAGTCAAAGTTGTATAGCCTTGACCATGGCCATGAGAAACCACAAGACAAAAAAAAGAGAACCTCTGGCCTTGCCACTCTCAAAAAGAAGTTTATTAAACGCCGAAAATCTAATAGATCGGCTGATCACGCCAAGCAGATGCGAGAACTCCTCTCTGGGTGGGATGTTAGAGATGTCAATGCACTAGTGGAAGAATATGAGGGAACTTCAGCCTTGAAGGAGCTTTCTCTGCAAGCCAGTTTGGCTAGGCCAGAAGCTCGGACCCTGCAGAAGGACATGGCCGACCTTTATGAGGATAAGTACTGTACTGACGTGGACTTAATATTTCAGGAAACTTGTTTTCCTGTTCACCGTGCCATTTTGGCAGCAAGGTGTCCATTTTTTAAAACCCTGCTTTCTTCTTCACCTGAGTATGGGGCAGAGATAATAATGGACATCAGTACAGCTGGTATTGATATGCCCATGTTTTCCGCCTTGTTACACTACCTTTATACAGGAGAGTTTGGAATGGAGGACTCAAGATTTCAGAATGTCGACATCCTTGTTCAGCTTAGTGAAGAATTTGGAACACCAAATCCCCTTGATGTAGATATGCGTGGACTCTTTGATTACATGTGTTATTATGATGTTGTCCTTAGTTTTTCTTCAGATTCTGAACTAGTTGAAGCTTTTGGTGGAAATCAGAACTGTTTAGATGAAGAGCTCAAAGCCCACAAGGCTATTATTTCTGCACGGTCCCCGTTTTTCCGAAATTTATTACAAAGGAGAATACGGACTGGTGAAGAAATCACAGACCGAACTTTGAGAACTCCCACAAGAATTATATTAGATGAGTCCATTATACCAAAAAAATATGCAAAAGTGATATTACACTGTATGTATACCGATGTGGTGGACCTCTCTGTTTTACACTGTAGCCCCTCTGTGGGGAGTCTCAGTGAAGTTCAGGCTCTCGTCGCAGGGAAGCCAAACATGACCAGGGCAGAAGAAGCCATGGAACTTTACCACATAGCACTATTCTTGGAATTTAACATGCTTGCACAAGGCTGTGAGGACATCATTGCTGAGAGCATCTCATTAGACACCTTAATTGCCGTCCTCAAGTGGAGCTCGCATCCATACGGCTCTAAGTGGGTGCACCGACAAGCTGTGCATTTCCTGTGTGAGGAGCTATCCCAGGTCATGACTTCGGATGTTTTTTATGAACTGAGCAAAGACCATCTGCTTACTGCTATCCAGTCTGACTACCTACAGGCAAGCGAACAAGATATCCTTAAATATCTGATTAAATGGGGTGAGCATCAGTTGATGAAAAGAATAGCAGACAGAGAGCCAAACTTACTGAGTGGCACTGCACATAGTGTGAACAAAAGAGGTGTGAAGAGAAGAGACCTGGACATAGAAGAACTTAGAGAGATCCTTTCTTCTCTCTTGCCTTTTGTGCGGATTGAACACATCCTACCTATAAACAGTGAGGTCTTAAGTGATGCAGGTTTATGGGAAAGATAA

Peptide sequence:

MGANASNYPHSCSPRVGGNSQAQQTFIGTSSYSQQGYGCESKLYSLDHGHEKPQDKKKRTSGLATLKKKFIKRRKSNRSADHAKQMRELLSGWDVRDVNALVEEYEGTSALKELSLQASLARPEARTLQKDMADLYEDKYCTDVDLIFQETCFPVHRAILAARCPFFKTLLSSSPEYGAEIIMDISTAGIDMPMFSALLHYLYTGEFGMEDSRFQNVDILVQLSEEFGTPNPLDVDMRGLFDYMCYYDVVLSFSSDSELVEAFGGNQNCLDEELKAHKAIISARSPFFRNLLQRRIRTGEEITDRTLRTPTRIILDESIIPKKYAKVILHCMYTDVVDLSVLHCSPSVGSLSEVQALVAGKPNMTRAEEAMELYHIALFLEFNMLAQGCEDIIAESISLDTLIAVLKWSSHPYGSKWVHRQAVHFLCEELSQVMTSDVFYELSKDHLLTAIQSDYLQASEQDILKYLIKWGEHQLMKRIADREPNLLSGTAHSVNKRGVKRRDLDIEELREILSSLLPFVRIEHILPINSEVLSDAGLWER

IRESfinder result

IRESfinder score

0.629405776

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page