top of page

mmu_circBtbd10_533

Basic information of circular RNA
PanCircBase ID:

mmu_circBtbd10_533

mm39_Chr. Position ID:

chr7|112921886|112929164|-

Gene name:

Btbd10

Transcript:

ENSMUST00000117577.8

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

4

Exon/intron indexes:

7,6,5,4

Exon/intron offsets:

0,3098,5659,7175

Genomic length:

7278

Exon/intron sizes in nt:

111,198,121,103

Flanking exon/introns:

chr7:112915946-112921886|chr7:112929164-112931816

Splice length:

533

Other database IDs:

circAtlas: mmu-Btbd10_0009

circAtlas: hsa-BTBD10_0009, CIRCpedia: HSA_CIRCpedia_128146

Human Ortholog IDs:
Mature spliced Sequence:

GATGTTTGGATCTGGCCGGGAACATAATTTCACACGTCCCAATGAGAAGGGAGAATATGAGGTGGCAGAGGGAATTGGTTCTACTGTGTTTCGAGCTATTTTGGATTACTATAAGACAGGAATCATCCGCTGTCCTGATGGCATATCGATTCCTGAACTGCGAGAAGCATGTGATTACCTTTGTATCTCTTTTGAATACAGTACAATTAAATGTAGAGATCTCAGTGCCCTTATGCATGAGTTATCAAATGATGGTGCTCGTAGACAATTTGAATTTTATCTGGAAGAAATGATCCTCCCTCTCATGGTAGCAAGCGCCCAGAGTGGGGAACGAGAGTGCCATATCGTAGTGCTTACAGATGATGATGTAGTTGATTGGGATGAGGAGTATCCACCACAGATGGGAGAAGAATATTCACAGATTATTTATAGCACAAAATTATATAGATTTTTCAAGTACATTGAAAACAGAGATGTGGCCAAATCAGTTTTGAAGGAGAGGGGTCTTAAGAAGATTAGATTGGGAATAGAAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

ACAGAGATGTGGCCAAATCAGT

59.96

AACCAATTCCCTCTGCCACC

60.25

146

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

ACAGAGATGTGGCCAAATCAGT

59.96

CAATTCCCTCTGCCACCTCA

59.67

143

PCR template sequence:

ACAAAATTATATAGATTTTTCAAGTACATTGAAAACAGAGATGTGGCCAAATCAGTTTTGAAGGAGAGGGGTCTTAAGAAGATTAGATTGGGAATAGAAGGATGTTTGGATCTGGCCGGGAACATAATTTCACACGTCCCAATGAGAAGGGAGAATATGAGGTGGCAGAGGGAATTGGTTCTACTGTGTTTCGAGCTATT

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

7

Interacting miRNAs (#binding sites)

mmu-miR-204-5p(1), mmu-miR-29b-3p(1), mmu-miR-29a-3p(1), mmu-miR-29c-3p(1), mmu-miR-196a-5p(1), mmu-miR-326-3p(1), mmu-miR-207(1)

siRNAs for circular RNA silencing
Junction sequence

TTGGGAATAGAAGGATGTTTGGATCT

siRNA sets

CAAACATCCTTCTATTCCC, CCAAACATCCTTCTATTCC, AACATCCTTCTATTCCCAA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCBTBD10_533_ORF_1

0.6748

0.041208472

0.89175446

825

ORF sequence:

ATGTTTGGATCTGGCCGGGAACATAATTTCACACGTCCCAATGAGAAGGGAGAATATGAGGTGGCAGAGGGAATTGGTTCTACTGTGTTTCGAGCTATTTTGGATTACTATAAGACAGGAATCATCCGCTGTCCTGATGGCATATCGATTCCTGAACTGCGAGAAGCATGTGATTACCTTTGTATCTCTTTTGAATACAGTACAATTAAATGTAGAGATCTCAGTGCCCTTATGCATGAGTTATCAAATGATGGTGCTCGTAGACAATTTGAATTTTATCTGGAAGAAATGATCCTCCCTCTCATGGTAGCAAGCGCCCAGAGTGGGGAACGAGAGTGCCATATCGTAGTGCTTACAGATGATGATGTAGTTGATTGGGATGAGGAGTATCCACCACAGATGGGAGAAGAATATTCACAGATTATTTATAGCACAAAATTATATAGATTTTTCAAGTACATTGAAAACAGAGATGTGGCCAAATCAGTTTTGAAGGAGAGGGGTCTTAAGAAGATTAGATTGGGAATAGAAGGATGTTTGGATCTGGCCGGGAACATAATTTCACACGTCCCAATGAGAAGGGAGAATATGAGGTGGCAGAGGGAATTGGTTCTACTGTGTTTCGAGCTATTTTGGATTACTATAAGACAGGAATCATCCGCTGTCCTGATGGCATATCGATTCCTGAACTGCGAGAAGCATGTGATTACCTTTGTATCTCTTTTGAATACAGTACAATTAAATGTAGAGATCTCAGTGCCCTTATGCATGAGTTATCAAATGATGGTGCTCGTAGACAATTTGAATTTTATCTGGAAGAAATGA

Peptide sequence:

MFGSGREHNFTRPNEKGEYEVAEGIGSTVFRAILDYYKTGIIRCPDGISIPELREACDYLCISFEYSTIKCRDLSALMHELSNDGARRQFEFYLEEMILPLMVASAQSGERECHIVVLTDDDVVDWDEEYPPQMGEEYSQIIYSTKLYRFFKYIENRDVAKSVLKERGLKKIRLGIEGCLDLAGNIISHVPMRRENMRWQRELVLLCFELFWITIRQESSAVLMAYRFLNCEKHVITFVSLLNTVQLNVEISVPLCMSYQMMVLVDNLNFIWKK

IRESfinder result

IRESfinder score

0.703316477

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page