top of page

mmu_circBtaf1_1659

Basic information of circular RNA
PanCircBase ID:

mmu_circBtaf1_1659

mm39_Chr. Position ID:

chr19|36935772|36959221|+

Gene name:

Btaf1

Transcript:

ENSMUST00000099494.4

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

13

Exon/intron indexes:

6,7,8,9,10,11,12,13,14,15,16,17,18

Exon/intron offsets:

0,3266,4058,7245,8119,8303,10683,11541,14525,19942,22204,22614,23274

Genomic length:

23449

Exon/intron sizes in nt:

1,37,13,06,99,09,61,77,00,00,00,00,00,00,00,00,00,000

Flanking exon/introns:

chr19:36933934-36935772|chr19:36959221-36960848

Splice length:

1659

Other database IDs:

CIRCpedia: MMU_CIRCpedia_223557, circAtlas: mmu-Btaf1_0045

circAtlas: hsa-BTAF1_0051

Human Ortholog IDs:
Mature spliced Sequence:

ACTCTCCAAGCAGCTGAATTGATTGATTCAGAATTCCGAGCAGGAATGAGTAATAGACAGAAGAACAAAGCTAAAAGAATGGCCAAGTTATTTGCAAAACAGAGATCCAGGGATGCAGTGGAAACGAATGAGAAGAGCAATGACAGCACTGATGGAGAGCCAGAAGAAAAGAGACGGAAAGTAGCAAATGTTGTTATTAATCAGACTGCAAGTGATTCCAAAGTCTTGATAGATAATGTTCCAGAAAGTTCTTCCTTAATTGAAGAGACAAATGAATGGCCTTTGGAAAGCTTTTGTGAAGAACTTTGCAATGACCTTTTTAATCCCTCCTGGGAGGTTCGACATGGGGCAGGTACTGGACTCAGAGAAATTCTTAAAGCTCATGGGAAAAGTGGTGGTAAAATGGGAGACAGCACTTTAGAGGAGATGATTCAGCAGCATCAAGAGTGGTTGGAAGACTTAGTCATTAGACTCCTTTGTGTTTTTGCGTTGGACAGATTTGGAGACTTCGTTTCTGATGAAGTTGTAGCGCCAGTTCGTGAGACTTGTGCTCAAACGTTAGGTGTGGTTTTAAAGCACATGAACGAAACAGGAGTTCATAAGACAGTGGATGTGCTGCTGAAATTATTGACACAAGAACAGTGGGAAGTTAGACATGGTGGTCTTCTGGGAATAAAATATGCTTTGGCAGTTCGTCAGGATGTAATTAATACTTTATTGCCTAAAGTCTTAACTCGAATAATCGAAGGACTCCAGGACCTTGATGACGATGTTAGAGCTGTTGCTGCAGCATCCCTGGTTCCTGTAGTAGAAAGCCTTGTCTACCTTCAGACACAAAAGGTACCCTCCATTATAAATACCTTATGGGATTCTCTTCTGGAATTAGATGATCTAACAGCTTCAACAAATAGTATTATGACTCTCCTTTCATCCATGTTAACTTACCCTCAGGTCCAGCAATGCAGTATTCAACAGTCACTCACAGTTTTAGTCCCACGTGTCTGGCCATTTTTGCATCACACTATATCTTCAGTTCGAAGAGCAGCATTGGAAACTCTCTTTACATTATTATCAACACAGGACGAGAACTCTTCATCTTGGCTCATACCTATCCTGTCGGATATGCTGAGACACATTTTTCAGTTTTGTGTTTTAGAAAGCAGCCAGGAAATTCTGGATCTTATTCACAAGGTTTGGATGGAGCTTTTGAGCAAGGCGTCAGTTCAGTATTTGGTAGCAGCTGCATGCCCATGGATGAGTGCTTGGCTTTGCCTAATGATGCAGCCTTCTCACTTACCTATTGATTTAAATATGCTGCTGGAAGTAAAAGCTAGAGCCAAGGAAAAAACAGGTGGTAAGGTACGGCAAGGTCAAATCCAGAATAAAGAAGTGCTTCAGGAGTATATTGCTGGTGCAGACACCATCATGGAAGACCCAGCGACCAGAGATTTTGTAGTTATGAGGGCCAGGATGATGGCAGCTAAGTTGTTAGGAGCACTCTGTTGCTATATTTGTGATCCAAGTGTAAATATGGTAAACCAGGAAATTAAACCAGCGGATTCCCTTGGCCAGTTACTGCTCTTCTATTTGAATTCCAAATCTGCTTTACAGAGAATTAGTGTTGCGTTAGTAATCTGTGAGTGGGCTGCTTTACAAAAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

TTCCCTTGGCCAGTTACTGC

60.25

TCCTGCTCGGAATTCTGAATCA

59.5

145

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

CCTTGGCCAGTTACTGCTCT

59.67

TCCTGCTCGGAATTCTGAATCA

59.5

142

PCR template sequence:

TTCCCTTGGCCAGTTACTGCTCTTCTATTTGAATTCCAAATCTGCTTTACAGAGAATTAGTGTTGCGTTAGTAATCTGTGAGTGGGCTGCTTTACAAAAGACTCTCCAAGCAGCTGAATTGATTGATTCAGAATTCCGAGCAGGAATGAGTAATAGACAGAAGAACAAAGCTAAAAGAATGGCCAAGTTATTTGCAAAAC

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

20

Interacting miRNAs (#binding sites)

mmu-miR-16-5p(2), mmu-miR-322-5p(2), mmu-miR-15b-5p(2), mmu-miR-217-5p(2), mmu-miR-134-5p(1), mmu-miR-15a-5p(1), mmu-miR-93-5p(1), mmu-miR-200b-3p(1), mmu-miR-106b-5p(1), mmu-miR-324-5p(1), mmu-miR-29b-1-5p(1), mmu-miR-676-3p(1), mmu-miR-127-5p(1), mmu-miR-218-5p(1), mmu-miR-541-5p(1), mmu-miR-499-5p(1), mmu-miR-369-3p(1), mmu-miR-1199-5p(1), mmu-miR-697(1), mmu-miR-193b-3p(1)

siRNAs for circular RNA silencing
Junction sequence

TGCTTTACAAAAGACTCTCCAAGCAG

siRNA sets

GAGAGTCTTTTGTAAAGCA, GGAGAGTCTTTTGTAAAGC

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCBTAF1_1659_ORF_1

0.9896

-0.021166683

0.999999998

3273

ORF sequence:

ATGAGTAATAGACAGAAGAACAAAGCTAAAAGAATGGCCAAGTTATTTGCAAAACAGAGATCCAGGGATGCAGTGGAAACGAATGAGAAGAGCAATGACAGCACTGATGGAGAGCCAGAAGAAAAGAGACGGAAAGTAGCAAATGTTGTTATTAATCAGACTGCAAGTGATTCCAAAGTCTTGATAGATAATGTTCCAGAAAGTTCTTCCTTAATTGAAGAGACAAATGAATGGCCTTTGGAAAGCTTTTGTGAAGAACTTTGCAATGACCTTTTTAATCCCTCCTGGGAGGTTCGACATGGGGCAGGTACTGGACTCAGAGAAATTCTTAAAGCTCATGGGAAAAGTGGTGGTAAAATGGGAGACAGCACTTTAGAGGAGATGATTCAGCAGCATCAAGAGTGGTTGGAAGACTTAGTCATTAGACTCCTTTGTGTTTTTGCGTTGGACAGATTTGGAGACTTCGTTTCTGATGAAGTTGTAGCGCCAGTTCGTGAGACTTGTGCTCAAACGTTAGGTGTGGTTTTAAAGCACATGAACGAAACAGGAGTTCATAAGACAGTGGATGTGCTGCTGAAATTATTGACACAAGAACAGTGGGAAGTTAGACATGGTGGTCTTCTGGGAATAAAATATGCTTTGGCAGTTCGTCAGGATGTAATTAATACTTTATTGCCTAAAGTCTTAACTCGAATAATCGAAGGACTCCAGGACCTTGATGACGATGTTAGAGCTGTTGCTGCAGCATCCCTGGTTCCTGTAGTAGAAAGCCTTGTCTACCTTCAGACACAAAAGGTACCCTCCATTATAAATACCTTATGGGATTCTCTTCTGGAATTAGATGATCTAACAGCTTCAACAAATAGTATTATGACTCTCCTTTCATCCATGTTAACTTACCCTCAGGTCCAGCAATGCAGTATTCAACAGTCACTCACAGTTTTAGTCCCACGTGTCTGGCCATTTTTGCATCACACTATATCTTCAGTTCGAAGAGCAGCATTGGAAACTCTCTTTACATTATTATCAACACAGGACGAGAACTCTTCATCTTGGCTCATACCTATCCTGTCGGATATGCTGAGACACATTTTTCAGTTTTGTGTTTTAGAAAGCAGCCAGGAAATTCTGGATCTTATTCACAAGGTTTGGATGGAGCTTTTGAGCAAGGCGTCAGTTCAGTATTTGGTAGCAGCTGCATGCCCATGGATGAGTGCTTGGCTTTGCCTAATGATGCAGCCTTCTCACTTACCTATTGATTTAAATATGCTGCTGGAAGTAAAAGCTAGAGCCAAGGAAAAAACAGGTGGTAAGGTACGGCAAGGTCAAATCCAGAATAAAGAAGTGCTTCAGGAGTATATTGCTGGTGCAGACACCATCATGGAAGACCCAGCGACCAGAGATTTTGTAGTTATGAGGGCCAGGATGATGGCAGCTAAGTTGTTAGGAGCACTCTGTTGCTATATTTGTGATCCAAGTGTAAATATGGTAAACCAGGAAATTAAACCAGCGGATTCCCTTGGCCAGTTACTGCTCTTCTATTTGAATTCCAAATCTGCTTTACAGAGAATTAGTGTTGCGTTAGTAATCTGTGAGTGGGCTGCTTTACAAAAGACTCTCCAAGCAGCTGAATTGATTGATTCAGAATTCCGAGCAGGAATGAGTAATAGACAGAAGAACAAAGCTAAAAGAATGGCCAAGTTATTTGCAAAACAGAGATCCAGGGATGCAGTGGAAACGAATGAGAAGAGCAATGACAGCACTGATGGAGAGCCAGAAGAAAAGAGACGGAAAGTAGCAAATGTTGTTATTAATCAGACTGCAAGTGATTCCAAAGTCTTGATAGATAATGTTCCAGAAAGTTCTTCCTTAATTGAAGAGACAAATGAATGGCCTTTGGAAAGCTTTTGTGAAGAACTTTGCAATGACCTTTTTAATCCCTCCTGGGAGGTTCGACATGGGGCAGGTACTGGACTCAGAGAAATTCTTAAAGCTCATGGGAAAAGTGGTGGTAAAATGGGAGACAGCACTTTAGAGGAGATGATTCAGCAGCATCAAGAGTGGTTGGAAGACTTAGTCATTAGACTCCTTTGTGTTTTTGCGTTGGACAGATTTGGAGACTTCGTTTCTGATGAAGTTGTAGCGCCAGTTCGTGAGACTTGTGCTCAAACGTTAGGTGTGGTTTTAAAGCACATGAACGAAACAGGAGTTCATAAGACAGTGGATGTGCTGCTGAAATTATTGACACAAGAACAGTGGGAAGTTAGACATGGTGGTCTTCTGGGAATAAAATATGCTTTGGCAGTTCGTCAGGATGTAATTAATACTTTATTGCCTAAAGTCTTAACTCGAATAATCGAAGGACTCCAGGACCTTGATGACGATGTTAGAGCTGTTGCTGCAGCATCCCTGGTTCCTGTAGTAGAAAGCCTTGTCTACCTTCAGACACAAAAGGTACCCTCCATTATAAATACCTTATGGGATTCTCTTCTGGAATTAGATGATCTAACAGCTTCAACAAATAGTATTATGACTCTCCTTTCATCCATGTTAACTTACCCTCAGGTCCAGCAATGCAGTATTCAACAGTCACTCACAGTTTTAGTCCCACGTGTCTGGCCATTTTTGCATCACACTATATCTTCAGTTCGAAGAGCAGCATTGGAAACTCTCTTTACATTATTATCAACACAGGACGAGAACTCTTCATCTTGGCTCATACCTATCCTGTCGGATATGCTGAGACACATTTTTCAGTTTTGTGTTTTAGAAAGCAGCCAGGAAATTCTGGATCTTATTCACAAGGTTTGGATGGAGCTTTTGAGCAAGGCGTCAGTTCAGTATTTGGTAGCAGCTGCATGCCCATGGATGAGTGCTTGGCTTTGCCTAATGATGCAGCCTTCTCACTTACCTATTGATTTAAATATGCTGCTGGAAGTAAAAGCTAGAGCCAAGGAAAAAACAGGTGGTAAGGTACGGCAAGGTCAAATCCAGAATAAAGAAGTGCTTCAGGAGTATATTGCTGGTGCAGACACCATCATGGAAGACCCAGCGACCAGAGATTTTGTAGTTATGAGGGCCAGGATGATGGCAGCTAAGTTGTTAGGAGCACTCTGTTGCTATATTTGTGATCCAAGTGTAAATATGGTAAACCAGGAAATTAAACCAGCGGATTCCCTTGGCCAGTTACTGCTCTTCTATTTGAATTCCAAATCTGCTTTACAGAGAATTAGTGTTGCGTTAGTAATCTGTGAGTGGGCTGCTTTACAAAAG

Peptide sequence:

MSNRQKNKAKRMAKLFAKQRSRDAVETNEKSNDSTDGEPEEKRRKVANVVINQTASDSKVLIDNVPESSSLIEETNEWPLESFCEELCNDLFNPSWEVRHGAGTGLREILKAHGKSGGKMGDSTLEEMIQQHQEWLEDLVIRLLCVFALDRFGDFVSDEVVAPVRETCAQTLGVVLKHMNETGVHKTVDVLLKLLTQEQWEVRHGGLLGIKYALAVRQDVINTLLPKVLTRIIEGLQDLDDDVRAVAAASLVPVVESLVYLQTQKVPSIINTLWDSLLELDDLTASTNSIMTLLSSMLTYPQVQQCSIQQSLTVLVPRVWPFLHHTISSVRRAALETLFTLLSTQDENSSSWLIPILSDMLRHIFQFCVLESSQEILDLIHKVWMELLSKASVQYLVAAACPWMSAWLCLMMQPSHLPIDLNMLLEVKARAKEKTGGKVRQGQIQNKEVLQEYIAGADTIMEDPATRDFVVMRARMMAAKLLGALCCYICDPSVNMVNQEIKPADSLGQLLLFYLNSKSALQRISVALVICEWAALQKTLQAAELIDSEFRAGMSNRQKNKAKRMAKLFAKQRSRDAVETNEKSNDSTDGEPEEKRRKVANVVINQTASDSKVLIDNVPESSSLIEETNEWPLESFCEELCNDLFNPSWEVRHGAGTGLREILKAHGKSGGKMGDSTLEEMIQQHQEWLEDLVIRLLCVFALDRFGDFVSDEVVAPVRETCAQTLGVVLKHMNETGVHKTVDVLLKLLTQEQWEVRHGGLLGIKYALAVRQDVINTLLPKVLTRIIEGLQDLDDDVRAVAAASLVPVVESLVYLQTQKVPSIINTLWDSLLELDDLTASTNSIMTLLSSMLTYPQVQQCSIQQSLTVLVPRVWPFLHHTISSVRRAALETLFTLLSTQDENSSSWLIPILSDMLRHIFQFCVLESSQEILDLIHKVWMELLSKASVQYLVAAACPWMSAWLCLMMQPSHLPIDLNMLLEVKARAKEKTGGKVRQGQIQNKEVLQEYIAGADTIMEDPATRDFVVMRARMMAAKLLGALCCYICDPSVNMVNQEIKPADSLGQLLLFYLNSKSALQRISVALVICEWAALQK

IRESfinder result

IRESfinder score

0.658021262

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page