top of page

mmu_circBrwd1_2154

Basic information of circular RNA
PanCircBase ID:

mmu_circBrwd1_2154

mm39_Chr. Position ID:

chr16|95844200|95869827|-

Gene name:

Brwd1

Transcript:

ENSMUST00000099502.9

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

16

Exon/intron indexes:

20,19,18,17,16,15,14,13,12,11,10,9,8,7,6,5

Exon/intron offsets:

0,1463,3344,3934,4318,9524,10831,13114,14462,15682,16581,17998,21749,23024,23495,25476

Genomic length:

25627

Exon/intron sizes in nt:

94,18,41,89,22,61,29,10,00,00,00,00,00,00,00,00,00,00,00,00,000

Flanking exon/introns:

chr16:95842583-95844200|chr16:95869827-95883013

Splice length:

2154

Other database IDs:

CIRCpedia: MMU_CIRCpedia_216478, circAtlas: mmu-Brwd1_0050

circBase: hsa_circ_0116049, circAtlas: hsa-BRWD1_0055, CIRCpedia: HSA_CIRCpedia_365416

Human Ortholog IDs:
Mature spliced Sequence:

GTCTTGTCCAATAAACATGTGGCTCCTGACCACCTACTACAGATATGCCAGCGCATCGGTCCGATGCTGGATAAGGAGGTCCCGCCCAGTATCTCAAGAGTCACTTCTTTGCTTGGTGCAGGAAGGCAGTCTTTGCTACGAACAGCAAAAGACTGCAGGCACACAGTGTGGAAGGGCTCTGCCTTTGCTGCTCTTCACAGAGGAAGACCTCCTGAAATGCCCGTCAATTATGGCCCCCCACCGAGTCTTGTGGAGATACACCGAGGAAGGCAGCTCACAGGGTGTTCCACTTTTAGCACAGCGTTCCCAGGAACTATGTACCAGCATATAAAGATGCACAGGAGGATTCTTGGACACCTGTCTGCAGTGTACTGTGTAGCATTTGATAGGACAGGACATAGAATCTTTACAGGTTCAGATGATTGCTTGGTAAAGATTTGGTCAACACATAATGGCCGCTTGTTGTCTACGTTAAGAGGCCATTCTGCAGAGATTTCAGACATGGCTGTGAACTACGAGAACACGCTGATTGCTGCAGGAAGCTGTGATAAGATCATTAGGGTGTGGTGCTTGAGGACCTGCGCCCCAGTTGCTGTGCTGCAAGGACACACGGGGTCAATCACATCTCTGCAGTTTAGCCCGATGGCCAAAGGACCTCAGCGGTACATGGTTTCTACGGGCGCTGATGGCACTGTTTGCTTCTGGCAGTGGGATTTAGAGTCCTTGAAGTTCAGTCCACGACCCCTGAAGTTCACGGAAAAGCCAAGGCCTGGTGTTCAGATGCTGTGTTCTTCATTTAGCGTTGGTGGTATGTTTTTAGCTACAGGTAGTACTGATCATGTAATCAGAATGTATTTTTTGGGATTCGACGCACCTGAAAAAATCGCCGAGCTTGAAAGCCACACTGACAAAGTTGATAGTATCCAGTTTTGTAACAATGGTGACCGGTTCTTAAGTGGTAGCCGAGATGGAACAGCACGGATCTGGAGGTTTGAGCAGTTGGAATGGAGAAGCATTTTACTGGACATGTCTGCCAGGATCTCGGGAGACACATCTTCAGAAGAAGAGAGGTTTATGAAACCCAAAGTTACAATGATTGCTTGGAACCAGGATGATAGCACCGTGGTCACAGCCGTGAATGATCATGTCCTCAAGGTGTGGAGTTCCTACACTGGACAGCTGCTTCATAACTTACTGGGACATGCTGATGAAGTGTTTGTTTTGGAGACACATCCCTTTGATTCCAGAATTATGTTATCTGCAGGACACGATGGCAGCATATTTATATGGGATATTACAAAGGGCATCAAGATGAAGCATTACTTTAATATGATCGAAGGACAAGGACATGGAGCTGTGTTTGACTGCAAGTTTTCACAGGATGGACAACATTTTGCCTGTACAGATTCTCACGGGCATCTTCTGATATTTGGCTTTGGATGCAGCAAGCCATATGAAAAGATTCCTGATCAGATGTTTTTTCATACTGACTACCGACCACTGATAAGAGATTCCAATAACTATGTCTTGGATGAGCAGACACAGCAGGCACCTCATCTTATGCCTCCACCATTCTTGGTGGATGTGGACGGAAACCCTCATCCAACCAAGTTCCAGAGATTAGTACCAGGTCGAGAAAACTCAGCAGATGAACATTTGGTTCCACAGCTAGGCTATGTGGCCACAAGTGATGGGGAGGTGATTGAACAGATTATAAGCCTGCATACCAACGACAGTGGAGATGCAAGCCCAGAGTCCAGCGTCTTGGATGGCATGATTAGGCAGCTGCAGCAGCAGCAAGACCAGAGACTGGGAGTGGATCAGGATGGGACTGCAAATGGACTTCCCAGTGGGGAAGGGACACCCCGAAGAGGGAGTTTTAGAAGACTGAGTTTAGACATTCAGTCTCCTCCAAACATCGGTCTCCGTCGGAGTGGGCAGGTTGAAGGTGTTCGTCAGATGCATCAGAACGCTCCTCGGAGTCAGATTGCTACAGAGCGTGACCTCCAGGCTTGGAAGCGGAGAGTAGTTGTTCCAGAGGCACCGCCTGGCATGTTCAGGCGGTTGGAAGACATTCGCATAGAGAGAGGCGAGGAGGAGAGGAACCTGTATGTAATAGGGAGAAAGAAGAAGACTTTCCAGGTCCCACAAAAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

CGAGGAGGAGAGGAACCTGT

60.32

TCTTGAGATACTGGGCGGGA

60.03

163

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

CGAGGAGGAGAGGAACCTGT

60.32

CTTGAGATACTGGGCGGGAC

59.89

162

PCR template sequence:

GTTCAGGCGGTTGGAAGACATTCGCATAGAGAGAGGCGAGGAGGAGAGGAACCTGTATGTAATAGGGAGAAAGAAGAAGACTTTCCAGGTCCCACAAAAGGTCTTGTCCAATAAACATGTGGCTCCTGACCACCTACTACAGATATGCCAGCGCATCGGTCCGATGCTGGATAAGGAGGTCCCGCCCAGTATCTCAAGAG

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

16

Interacting miRNAs (#binding sites)

mmu-miR-9-5p(1), mmu-miR-155-5p(1), mmu-miR-221-3p(1), mmu-miR-135a-5p(1), mmu-miR-148a-3p(1), mmu-miR-298-5p(1), mmu-miR-326-3p(1), mmu-miR-10b-5p(1), mmu-miR-10a-5p(1), mmu-miR-382-3p(1), mmu-miR-383-5p(1), mmu-miR-342-5p(1), mmu-miR-207(1), mmu-miR-673-5p(1), mmu-miR-335-3p(1), mmu-miR-338-3p(1)

siRNAs for circular RNA silencing
Junction sequence

GGTCCCACAAAAGGTCTTGTCCAATA

siRNA sets

TTGGACAAGACCTTTTGTG, TATTGGACAAGACCTTTTG, CAAGACCTTTTGTGGGACC

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCBRWD1_2154_ORF_1

0.7713

0.126427103

1

4245

ORF sequence:

ATGCTGGATAAGGAGGTCCCGCCCAGTATCTCAAGAGTCACTTCTTTGCTTGGTGCAGGAAGGCAGTCTTTGCTACGAACAGCAAAAGACTGCAGGCACACAGTGTGGAAGGGCTCTGCCTTTGCTGCTCTTCACAGAGGAAGACCTCCTGAAATGCCCGTCAATTATGGCCCCCCACCGAGTCTTGTGGAGATACACCGAGGAAGGCAGCTCACAGGGTGTTCCACTTTTAGCACAGCGTTCCCAGGAACTATGTACCAGCATATAAAGATGCACAGGAGGATTCTTGGACACCTGTCTGCAGTGTACTGTGTAGCATTTGATAGGACAGGACATAGAATCTTTACAGGTTCAGATGATTGCTTGGTAAAGATTTGGTCAACACATAATGGCCGCTTGTTGTCTACGTTAAGAGGCCATTCTGCAGAGATTTCAGACATGGCTGTGAACTACGAGAACACGCTGATTGCTGCAGGAAGCTGTGATAAGATCATTAGGGTGTGGTGCTTGAGGACCTGCGCCCCAGTTGCTGTGCTGCAAGGACACACGGGGTCAATCACATCTCTGCAGTTTAGCCCGATGGCCAAAGGACCTCAGCGGTACATGGTTTCTACGGGCGCTGATGGCACTGTTTGCTTCTGGCAGTGGGATTTAGAGTCCTTGAAGTTCAGTCCACGACCCCTGAAGTTCACGGAAAAGCCAAGGCCTGGTGTTCAGATGCTGTGTTCTTCATTTAGCGTTGGTGGTATGTTTTTAGCTACAGGTAGTACTGATCATGTAATCAGAATGTATTTTTTGGGATTCGACGCACCTGAAAAAATCGCCGAGCTTGAAAGCCACACTGACAAAGTTGATAGTATCCAGTTTTGTAACAATGGTGACCGGTTCTTAAGTGGTAGCCGAGATGGAACAGCACGGATCTGGAGGTTTGAGCAGTTGGAATGGAGAAGCATTTTACTGGACATGTCTGCCAGGATCTCGGGAGACACATCTTCAGAAGAAGAGAGGTTTATGAAACCCAAAGTTACAATGATTGCTTGGAACCAGGATGATAGCACCGTGGTCACAGCCGTGAATGATCATGTCCTCAAGGTGTGGAGTTCCTACACTGGACAGCTGCTTCATAACTTACTGGGACATGCTGATGAAGTGTTTGTTTTGGAGACACATCCCTTTGATTCCAGAATTATGTTATCTGCAGGACACGATGGCAGCATATTTATATGGGATATTACAAAGGGCATCAAGATGAAGCATTACTTTAATATGATCGAAGGACAAGGACATGGAGCTGTGTTTGACTGCAAGTTTTCACAGGATGGACAACATTTTGCCTGTACAGATTCTCACGGGCATCTTCTGATATTTGGCTTTGGATGCAGCAAGCCATATGAAAAGATTCCTGATCAGATGTTTTTTCATACTGACTACCGACCACTGATAAGAGATTCCAATAACTATGTCTTGGATGAGCAGACACAGCAGGCACCTCATCTTATGCCTCCACCATTCTTGGTGGATGTGGACGGAAACCCTCATCCAACCAAGTTCCAGAGATTAGTACCAGGTCGAGAAAACTCAGCAGATGAACATTTGGTTCCACAGCTAGGCTATGTGGCCACAAGTGATGGGGAGGTGATTGAACAGATTATAAGCCTGCATACCAACGACAGTGGAGATGCAAGCCCAGAGTCCAGCGTCTTGGATGGCATGATTAGGCAGCTGCAGCAGCAGCAAGACCAGAGACTGGGAGTGGATCAGGATGGGACTGCAAATGGACTTCCCAGTGGGGAAGGGACACCCCGAAGAGGGAGTTTTAGAAGACTGAGTTTAGACATTCAGTCTCCTCCAAACATCGGTCTCCGTCGGAGTGGGCAGGTTGAAGGTGTTCGTCAGATGCATCAGAACGCTCCTCGGAGTCAGATTGCTACAGAGCGTGACCTCCAGGCTTGGAAGCGGAGAGTAGTTGTTCCAGAGGCACCGCCTGGCATGTTCAGGCGGTTGGAAGACATTCGCATAGAGAGAGGCGAGGAGGAGAGGAACCTGTATGTAATAGGGAGAAAGAAGAAGACTTTCCAGGTCCCACAAAAGGTCTTGTCCAATAAACATGTGGCTCCTGACCACCTACTACAGATATGCCAGCGCATCGGTCCGATGCTGGATAAGGAGGTCCCGCCCAGTATCTCAAGAGTCACTTCTTTGCTTGGTGCAGGAAGGCAGTCTTTGCTACGAACAGCAAAAGACTGCAGGCACACAGTGTGGAAGGGCTCTGCCTTTGCTGCTCTTCACAGAGGAAGACCTCCTGAAATGCCCGTCAATTATGGCCCCCCACCGAGTCTTGTGGAGATACACCGAGGAAGGCAGCTCACAGGGTGTTCCACTTTTAGCACAGCGTTCCCAGGAACTATGTACCAGCATATAAAGATGCACAGGAGGATTCTTGGACACCTGTCTGCAGTGTACTGTGTAGCATTTGATAGGACAGGACATAGAATCTTTACAGGTTCAGATGATTGCTTGGTAAAGATTTGGTCAACACATAATGGCCGCTTGTTGTCTACGTTAAGAGGCCATTCTGCAGAGATTTCAGACATGGCTGTGAACTACGAGAACACGCTGATTGCTGCAGGAAGCTGTGATAAGATCATTAGGGTGTGGTGCTTGAGGACCTGCGCCCCAGTTGCTGTGCTGCAAGGACACACGGGGTCAATCACATCTCTGCAGTTTAGCCCGATGGCCAAAGGACCTCAGCGGTACATGGTTTCTACGGGCGCTGATGGCACTGTTTGCTTCTGGCAGTGGGATTTAGAGTCCTTGAAGTTCAGTCCACGACCCCTGAAGTTCACGGAAAAGCCAAGGCCTGGTGTTCAGATGCTGTGTTCTTCATTTAGCGTTGGTGGTATGTTTTTAGCTACAGGTAGTACTGATCATGTAATCAGAATGTATTTTTTGGGATTCGACGCACCTGAAAAAATCGCCGAGCTTGAAAGCCACACTGACAAAGTTGATAGTATCCAGTTTTGTAACAATGGTGACCGGTTCTTAAGTGGTAGCCGAGATGGAACAGCACGGATCTGGAGGTTTGAGCAGTTGGAATGGAGAAGCATTTTACTGGACATGTCTGCCAGGATCTCGGGAGACACATCTTCAGAAGAAGAGAGGTTTATGAAACCCAAAGTTACAATGATTGCTTGGAACCAGGATGATAGCACCGTGGTCACAGCCGTGAATGATCATGTCCTCAAGGTGTGGAGTTCCTACACTGGACAGCTGCTTCATAACTTACTGGGACATGCTGATGAAGTGTTTGTTTTGGAGACACATCCCTTTGATTCCAGAATTATGTTATCTGCAGGACACGATGGCAGCATATTTATATGGGATATTACAAAGGGCATCAAGATGAAGCATTACTTTAATATGATCGAAGGACAAGGACATGGAGCTGTGTTTGACTGCAAGTTTTCACAGGATGGACAACATTTTGCCTGTACAGATTCTCACGGGCATCTTCTGATATTTGGCTTTGGATGCAGCAAGCCATATGAAAAGATTCCTGATCAGATGTTTTTTCATACTGACTACCGACCACTGATAAGAGATTCCAATAACTATGTCTTGGATGAGCAGACACAGCAGGCACCTCATCTTATGCCTCCACCATTCTTGGTGGATGTGGACGGAAACCCTCATCCAACCAAGTTCCAGAGATTAGTACCAGGTCGAGAAAACTCAGCAGATGAACATTTGGTTCCACAGCTAGGCTATGTGGCCACAAGTGATGGGGAGGTGATTGAACAGATTATAAGCCTGCATACCAACGACAGTGGAGATGCAAGCCCAGAGTCCAGCGTCTTGGATGGCATGATTAGGCAGCTGCAGCAGCAGCAAGACCAGAGACTGGGAGTGGATCAGGATGGGACTGCAAATGGACTTCCCAGTGGGGAAGGGACACCCCGAAGAGGGAGTTTTAGAAGACTGAGTTTAGACATTCAGTCTCCTCCAAACATCGGTCTCCGTCGGAGTGGGCAGGTTGAAGGTGTTCGTCAGATGCATCAGAACGCTCCTCGGAGTCAGATTGCTACAGAGCGTGACCTCCAGGCTTGGAAGCGGAGAGTAGTTGTTCCAGAGGCACCGCCTGGCATGTTCAGGCGGTTGGAAGACATTCGCATAGAGAGAGGCGAGGAGGAGAGGAACCTGTATGTAATAGGGAGAAAGAAGAAGACTTTCCAGGTCCCACAAAAG

Peptide sequence:

MLDKEVPPSISRVTSLLGAGRQSLLRTAKDCRHTVWKGSAFAALHRGRPPEMPVNYGPPPSLVEIHRGRQLTGCSTFSTAFPGTMYQHIKMHRRILGHLSAVYCVAFDRTGHRIFTGSDDCLVKIWSTHNGRLLSTLRGHSAEISDMAVNYENTLIAAGSCDKIIRVWCLRTCAPVAVLQGHTGSITSLQFSPMAKGPQRYMVSTGADGTVCFWQWDLESLKFSPRPLKFTEKPRPGVQMLCSSFSVGGMFLATGSTDHVIRMYFLGFDAPEKIAELESHTDKVDSIQFCNNGDRFLSGSRDGTARIWRFEQLEWRSILLDMSARISGDTSSEEERFMKPKVTMIAWNQDDSTVVTAVNDHVLKVWSSYTGQLLHNLLGHADEVFVLETHPFDSRIMLSAGHDGSIFIWDITKGIKMKHYFNMIEGQGHGAVFDCKFSQDGQHFACTDSHGHLLIFGFGCSKPYEKIPDQMFFHTDYRPLIRDSNNYVLDEQTQQAPHLMPPPFLVDVDGNPHPTKFQRLVPGRENSADEHLVPQLGYVATSDGEVIEQIISLHTNDSGDASPESSVLDGMIRQLQQQQDQRLGVDQDGTANGLPSGEGTPRRGSFRRLSLDIQSPPNIGLRRSGQVEGVRQMHQNAPRSQIATERDLQAWKRRVVVPEAPPGMFRRLEDIRIERGEEERNLYVIGRKKKTFQVPQKVLSNKHVAPDHLLQICQRIGPMLDKEVPPSISRVTSLLGAGRQSLLRTAKDCRHTVWKGSAFAALHRGRPPEMPVNYGPPPSLVEIHRGRQLTGCSTFSTAFPGTMYQHIKMHRRILGHLSAVYCVAFDRTGHRIFTGSDDCLVKIWSTHNGRLLSTLRGHSAEISDMAVNYENTLIAAGSCDKIIRVWCLRTCAPVAVLQGHTGSITSLQFSPMAKGPQRYMVSTGADGTVCFWQWDLESLKFSPRPLKFTEKPRPGVQMLCSSFSVGGMFLATGSTDHVIRMYFLGFDAPEKIAELESHTDKVDSIQFCNNGDRFLSGSRDGTARIWRFEQLEWRSILLDMSARISGDTSSEEERFMKPKVTMIAWNQDDSTVVTAVNDHVLKVWSSYTGQLLHNLLGHADEVFVLETHPFDSRIMLSAGHDGSIFIWDITKGIKMKHYFNMIEGQGHGAVFDCKFSQDGQHFACTDSHGHLLIFGFGCSKPYEKIPDQMFFHTDYRPLIRDSNNYVLDEQTQQAPHLMPPPFLVDVDGNPHPTKFQRLVPGRENSADEHLVPQLGYVATSDGEVIEQIISLHTNDSGDASPESSVLDGMIRQLQQQQDQRLGVDQDGTANGLPSGEGTPRRGSFRRLSLDIQSPPNIGLRRSGQVEGVRQMHQNAPRSQIATERDLQAWKRRVVVPEAPPGMFRRLEDIRIERGEEERNLYVIGRKKKTFQVPQK

IRESfinder result

IRESfinder score

0.48149785

IRES/non IRES

non-IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page