top of page

mmu_circBoll_367

Basic information of circular RNA
PanCircBase ID:

mmu_circBoll_367

mm39_Chr. Position ID:

chr1|55385535|55399918|-

Gene name:

Boll

Transcript:

ENSMUST00000114423.7

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

4

Exon/intron indexes:

5,4,3,2

Exon/intron offsets:

0,2504,9271,14239

Genomic length:

14383

Exon/intron sizes in nt:

76,55,92,144

Flanking exon/introns:

chr1:55379759-55385535|chr1:55399918-55401640

Splice length:

367

Other database IDs:

circAtlas: mmu-Boll_0009

Human Ortholog IDs:
Mature spliced Sequence:

CAGTCAACAAATCAGACACAAACAGATTCATTATCTCCATCCCCTAATCCTGTGTCACCTGTGCCTTTGAATAACCCAACAAGTGGCCCAAGATACGGAACTGTGATCCCTAACCGCATCTTTGTAGGAGGAATTGACTTTAAGACAAACGAAAATGATTTAAGAAAATTTTTCTCCCAATATGGGTCTGTAAAAGAAGTGAAGATTGTTAATGACAGAGCTGGAGTGTCCAAAGGGTATGGTTTCATCACTTTTGAAACTCAAGAAGATGCACAAAAAATCTTACAAGAGGCTGAAAAACTCAATTATAAGGATAAGAAACTCAACATTGGTCCAGCAATAAGAAAACAACAAGTAGGGATTCCTC

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

ACTCAACATTGGTCCAGCAA

57.64

CCGTATCTTGGGCCACTTGT

60.04

145

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

AACTCAACATTGGTCCAGCA

57.64

CCGTATCTTGGGCCACTTGT

60.04

146

PCR template sequence:

GATGCACAAAAAATCTTACAAGAGGCTGAAAAACTCAATTATAAGGATAAGAAACTCAACATTGGTCCAGCAATAAGAAAACAACAAGTAGGGATTCCTCCAGTCAACAAATCAGACACAAACAGATTCATTATCTCCATCCCCTAATCCTGTGTCACCTGTGCCTTTGAATAACCCAACAAGTGGCCCAAGATACGGAA

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

1

Interacting miRNAs (#binding sites)

mmu-miR-124-3p(1)

siRNAs for circular RNA silencing
Junction sequence

GTAGGGATTCCTCCAGTCAACAAATC

siRNA sets

TTTGTTGACTGGAGGAATC,TTGTTGACTGGAGGAATCC

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.740721068

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page