top of page

mmu_circBard1_1501

Basic information of circular RNA
PanCircBase ID:

mmu_circBard1_1501

mm39_Chr. Position ID:

chr1|71092771|71128686|-

Gene name:

Bard1

Transcript:

ENSMUST00000027393.8

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

6

Exon/intron indexes:

7,6,5,4,3,2

Exon/intron offsets:

0,11866,13495,20930,34496,35858

Genomic length:

35915

Exon/intron sizes in nt:

109,173,81,938,143,57

Flanking exon/introns:

chr1:71086931-71092771|chr1:71128686-71141826

Splice length:

1501

Other database IDs:

CIRCpedia: MMU_CIRCpedia_27699, circAtlas: mmu-Bard1_0006

circBase: hsa_circ_0002999, circAtlas: hsa-BARD1_0007, CIRCpedia: HSA_CIRCpedia_39561

Human Ortholog IDs:
Mature spliced Sequence:

TGCTAATATTCTGAAGGAGCCCGTGTGCTTAGGAGGATGTGAGCACATCTTCTGTAGTGGTTGTATAAGTGACTGTGTTGGCTCAGGATGCCCAGTGTGTTACACCCCAGCCTGGATCCTAGACCTCAAGATAAACCGACAATTGGACAGCATGATCCAGCTTTCTAGTAAGCTCCAAAATTTGCTCCATGACAATAAAGATTCAAAAGACAACACATCTAGGGCAAGTTTATTTGGTGATGCAGAAAGGAAGAAGAATTCAATAAAAATGTGGTTTAGTCCTCGAAGTAAGAAGGTTAGATATGTTGTGACTAAAGTGTCAGTACAAACACAGCCTCAAAAGGCAAAGGACGACAAAGCCCAGGAAGCCTCAATGTATGAATTTGTTTCCGCAACTCCCCCTGTAGCTGTTCCTAAGAGTGCTAAAACAGCTTCTAGAACATCTGCAAAAAAGCATCCAAAGAAATCTGTAGCTAAGATCAACAGGGAGGAGAATTTAAGGCCAGAAACAAAGGATAGTAGATTTGATTCCAAAGAGGAGCTGAAGGAAGAGAAGGTTGTCTCCTGTAGCCAAATACCAGTTATGGAGAGACCACGGGTAAATGGTGAAATAGACTTATTAGCAAGTGGTTCTGTTGTAGAACCTGAATGTTCTGGAAGCTTGACTGAAGTCTCTTTACCATTGGCTGAGCATATAGTGTCTCCAGACACTGTGAGCAAGAATGAAGAGACTCCGGAGAAGAAGGTCTGTGTAAAAGATCTTCGTTCAGGAGGGAGTAATGGAAATCGTAAAGGCTGCCACAGGCCTACCACTTCTACTTCTGACAGTTGTGGGAGCAACATTCCGAGCACCAGCAGAGGCATCGGTGAGCCAGCATTGCTTGCAGAAAACGTAGTGTTGGTTGACTGCTCTTCACTGCCTTCAGGCCAGCTACAGGTTGATGTCACACTCAGGAGAAAGAGTAACGCATCAGATGACCCCCTTAGCCTTTCACCGGGCACACCCCCACCTCTGCTGAACAATTCAACTCACAGACAAATGATGTCAAGCCCCTCCACAGTGAAGCTGTCTTCTGGTATGCCAGCCAGGAAAAGAAATCACAGAGGAGAGACCTTACTTCATATTGCTTCTATTAAGGGTGATATACCTTCTGTTGAATACCTCTTGCAAAATGGAAACGACCCAAATGTTAAAGACCATGCTGGATGGACACCGTTGCATGAAGCCTGCAGTCATGGGCACCTGAAGGTAGTGGAGTTGCTGCTCCAGCATAATGCCCTGGTGAACACCCCTGGCTATCAGAATGACTCGCCACTCCACGATGCCGTCAAGAGTGGCCACATCGATATAGTCAAGGTGTTACTGTCCCACGGTGCTTCCAGGAATGCTGTTAACATATTTGGTGTGCGGCCTGTGGACTATACAGACAATGAGAATATAAGATCATTATTGCTGCTGCCAGAGGAGAATGAATCATTCTCAACTAGCCAGTGCTCTATC

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

TATTGCTGCTGCCAGAGGAG

59.82

TCCTGAGCCAACACAGTCAC

59.89

141

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

TATTGCTGCTGCCAGAGGAG

59.82

CCTGAGCCAACACAGTCACT

59.89

140

PCR template sequence:

TGGTGTGCGGCCTGTGGACTATACAGACAATGAGAATATAAGATCATTATTGCTGCTGCCAGAGGAGAATGAATCATTCTCAACTAGCCAGTGCTCTATCTGCTAATATTCTGAAGGAGCCCGTGTGCTTAGGAGGATGTGAGCACATCTTCTGTAGTGGTTGTATAAGTGACTGTGTTGGCTCAGGATGCCCAGTGTGT

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

18

Interacting miRNAs (#binding sites)

mmu-miR-322-5p(2), mmu-miR-15b-5p(2), mmu-miR-335-3p(2), mmu-miR-16-5p(1), mmu-miR-15a-5p(1), mmu-miR-27b-3p(1), mmu-miR-27a-3p(1), mmu-miR-34c-5p(1), mmu-miR-298-5p(1), mmu-miR-320-3p(1), mmu-miR-138-5p(1), mmu-miR-149-5p(1), mmu-miR-34b-5p(1), mmu-miR-325-3p(1), mmu-miR-344d-3p(1), mmu-miR-207(1), mmu-miR-202-3p(1), mmu-miR-181d-5p(1)

siRNAs for circular RNA silencing
Junction sequence

CCAGTGCTCTATCTGCTAATATTCTG

siRNA sets

AATATTAGCAGATAGAGCA, ATATTAGCAGATAGAGCAC, TATTAGCAGATAGAGCACT

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCBARD1_1501_ORF_1

0.8851

0.06701273

0.999533283

1533

ORF sequence:

ATGAATCATTCTCAACTAGCCAGTGCTCTATCTGCTAATATTCTGAAGGAGCCCGTGTGCTTAGGAGGATGTGAGCACATCTTCTGTAGTGGTTGTATAAGTGACTGTGTTGGCTCAGGATGCCCAGTGTGTTACACCCCAGCCTGGATCCTAGACCTCAAGATAAACCGACAATTGGACAGCATGATCCAGCTTTCTAGTAAGCTCCAAAATTTGCTCCATGACAATAAAGATTCAAAAGACAACACATCTAGGGCAAGTTTATTTGGTGATGCAGAAAGGAAGAAGAATTCAATAAAAATGTGGTTTAGTCCTCGAAGTAAGAAGGTTAGATATGTTGTGACTAAAGTGTCAGTACAAACACAGCCTCAAAAGGCAAAGGACGACAAAGCCCAGGAAGCCTCAATGTATGAATTTGTTTCCGCAACTCCCCCTGTAGCTGTTCCTAAGAGTGCTAAAACAGCTTCTAGAACATCTGCAAAAAAGCATCCAAAGAAATCTGTAGCTAAGATCAACAGGGAGGAGAATTTAAGGCCAGAAACAAAGGATAGTAGATTTGATTCCAAAGAGGAGCTGAAGGAAGAGAAGGTTGTCTCCTGTAGCCAAATACCAGTTATGGAGAGACCACGGGTAAATGGTGAAATAGACTTATTAGCAAGTGGTTCTGTTGTAGAACCTGAATGTTCTGGAAGCTTGACTGAAGTCTCTTTACCATTGGCTGAGCATATAGTGTCTCCAGACACTGTGAGCAAGAATGAAGAGACTCCGGAGAAGAAGGTCTGTGTAAAAGATCTTCGTTCAGGAGGGAGTAATGGAAATCGTAAAGGCTGCCACAGGCCTACCACTTCTACTTCTGACAGTTGTGGGAGCAACATTCCGAGCACCAGCAGAGGCATCGGTGAGCCAGCATTGCTTGCAGAAAACGTAGTGTTGGTTGACTGCTCTTCACTGCCTTCAGGCCAGCTACAGGTTGATGTCACACTCAGGAGAAAGAGTAACGCATCAGATGACCCCCTTAGCCTTTCACCGGGCACACCCCCACCTCTGCTGAACAATTCAACTCACAGACAAATGATGTCAAGCCCCTCCACAGTGAAGCTGTCTTCTGGTATGCCAGCCAGGAAAAGAAATCACAGAGGAGAGACCTTACTTCATATTGCTTCTATTAAGGGTGATATACCTTCTGTTGAATACCTCTTGCAAAATGGAAACGACCCAAATGTTAAAGACCATGCTGGATGGACACCGTTGCATGAAGCCTGCAGTCATGGGCACCTGAAGGTAGTGGAGTTGCTGCTCCAGCATAATGCCCTGGTGAACACCCCTGGCTATCAGAATGACTCGCCACTCCACGATGCCGTCAAGAGTGGCCACATCGATATAGTCAAGGTGTTACTGTCCCACGGTGCTTCCAGGAATGCTGTTAACATATTTGGTGTGCGGCCTGTGGACTATACAGACAATGAGAATATAAGATCATTATTGCTGCTGCCAGAGGAGAATGAATCATTCTCAACTAGCCAGTGCTCTATC

Peptide sequence:

MNHSQLASALSANILKEPVCLGGCEHIFCSGCISDCVGSGCPVCYTPAWILDLKINRQLDSMIQLSSKLQNLLHDNKDSKDNTSRASLFGDAERKKNSIKMWFSPRSKKVRYVVTKVSVQTQPQKAKDDKAQEASMYEFVSATPPVAVPKSAKTASRTSAKKHPKKSVAKINREENLRPETKDSRFDSKEELKEEKVVSCSQIPVMERPRVNGEIDLLASGSVVEPECSGSLTEVSLPLAEHIVSPDTVSKNEETPEKKVCVKDLRSGGSNGNRKGCHRPTTSTSDSCGSNIPSTSRGIGEPALLAENVVLVDCSSLPSGQLQVDVTLRRKSNASDDPLSLSPGTPPPLLNNSTHRQMMSSPSTVKLSSGMPARKRNHRGETLLHIASIKGDIPSVEYLLQNGNDPNVKDHAGWTPLHEACSHGHLKVVELLLQHNALVNTPGYQNDSPLHDAVKSGHIDIVKVLLSHGASRNAVNIFGVRPVDYTDNENIRSLLLLPEENESFSTSQCSI

IRESfinder result

IRESfinder score

0.490653016

IRES/non IRES

non-IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page