top of page

mmu_circAtrx_3653

Basic information of circular RNA
PanCircBase ID:

mmu_circAtrx_3653

mm39_Chr. Position ID:

chrX|104918165|104943599|-

Gene name:

Atrx

Transcript:

ENSMUST00000113573.8

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

8

Exon/intron indexes:

9,8,7,6,5,4,3,2

Exon/intron offsets:

0,3807,5349,9747,13155,14433,16357,25321

Genomic length:

25434

Exon/intron sizes in nt:

3014,68,110,114,125,53,56,113

Flanking exon/introns:

chrX:104911529-104918165|chrX:104943599-104972705

Splice length:

3653

Other database IDs:

circAtlas: mmu-Atrx_0109

circAtlas: hsa-ATRX_0040, CIRCpedia: HSA_CIRCpedia_142069

Human Ortholog IDs:
Mature spliced Sequence:

TGGAAACAAGTTGAGTACATTGGTGCAGAAGCTTCATGACTTCTTAGCACACTCATCAGAAGAATCTGAGGAAACGTGTTCTTCTCCACGACTTGTCATGAACCAAAGCACAGATAAAATCTGTGGTTCTGGACTTAATTCTGATATGATGGAAAATAACAAGGAAGAGGGAGCTAGCACCTCAGAAAAATCCAGATCTTCAGGTTCATCAAGGTCAAAGAGGAAACCTTCAATTGTGACAAAATATGTAGAATCTGATGATGAAAAACCCACGGATGAGAATGTAAATGAAAAAGCTGCTACTGAGAATTCAGAAAATGACATTACTATGCAAAGCTTGCCAAAAGGTACAGTGATTGTACAACCAGAGCCAGTGCTGAATGAAGACAAAGATGATTTTAAAGGGCCTGAATTTAGAAGCAGAAGTAAAATGAAAGCTGACAATCTCAAAAAACGCGGAGAAGATGGACTTCATGGGATCGTGAGCTGCACAGCTTGTGGACAGCAGGTCAATCATTTTCAAAAAGATTCCATTTATAGACACCCTTCACTCAAAGTCCTTATCTGTAAGAACTGCTTTAAGTATTATATGAGTGACGATATTAGCCGTGACTCAGATGGAATGGATGAACAATGTAGATGGTGTGCAGAAGGTGGGAACTTGATTTGTTGTGACTTTTGTCATAACGCCTTCTGTAAGAAATGCATCCTGCGCAACCTTGGTCGAAAGGAGTTGTCTACAATAATGGATGAAAACAATCAGTGGTATTGCTATATTTGTCAACCAGAGCCTCTACTGGACTTGGTGACTGCGTGCAACAGCGTATTTGAGAATTTAGAACAGTTGTTGCAACAGAATAAGAAGAAGATAAAAGTTGACAGTGAAAAGACTAGTAAAGTCTGTGACCAAACATCCAAATTTTCTCCAAAGAAGAGTAGTTCTAGTTGTAATGGAGAAGAAAAAAAGTTAGAGGAGTCCTGTTCTGGTTCTGTAAGCTCCACTTACTCTCACTCAGCACTATCTGTGCCCAAAGAGATGATTAAGAAGACAACAAAACTGATTGAGACTACATCCAACATGAACTCCAGTTACATTAAGTTTCTAAAACAGGCAGCAGATAATTCAGAAATGACTTCTGCTATGAAGTTATGTCAACTTAAGTCTTTTAAATCTGTGTTGGATGATATCAAGAAGGCTCATCTTGCATTAGAAGAAGATTTGAATTCAGAGATCCAAGCTTTGGATGATGTACACAAAGAAAAAAATACCAAAGACCTTAAAAGCACAGATGCTAAGTCTGAAACAAAATTAGGAAAAGGGGAAAAATCCTATTCTACAGAAAAGAGAGAGTTTTTAAAGTTAGATGCTAGATCATCAGTAAAGGCCATAGATGGTGAAGAGCAGAGAGCACACAAAAGTACTAGTGGGGAACATAAGGGTTCAGGTAGGAAAGATGGCTCTCAGTATGAACCCACTAACACTCCTGAGGATTTAGATATGGATATTGTGTCTGTTCCTTCCTCGGTTCCAGAAGACATTTTTGATAGCCTTGAGAGTGCTATGGAAGTTCAGAGTTCAGCTGATTATCAAGGAGACGGCAACAGTGGGACTGAGCCAGAACTGGAGAGCTCCTCTGTAAAATTAAATGTTTCTTCAAAAGACAGCAGAGGAAATATTAAGTCAAAAGTCACAGCGAAAGTAAGAAAAGAATTATTTGTTAAACTTACCCCAGTTTCCCTTTCTAATTCCCCAATTAAAGGTGTTGACTGTCAGGAAGTGTCACAAGAGAAGAATGGCCGTAAAAGTTCTGGGGTGGCCCGCAGCTCAGAGAAATGTAGACCCAGAGAGGAAATTAGTGATCATGAAAACAATGTCACAATACTTTTAGAAGACTCCGATCTTCGAAGATCCCCACGTGTAAAAACTACACCGTTGAGGCGACAGACAGAAAGCAACCCTGCAATGTCGAATTCAGATGAAGAAAGTAATGGAACTATGAAGGAGAAACAAAAGATGTCAGGTCCAATAAGAAAAAAGGATAAGAGAAACTCAGCTGACTGTGCTACTGATAACCCTAAACCTCACAAGGTACCCAAAGCTAAGCAACCAGTGATTGGGGATCAGAATTCAGATTCTGATGAAATGCTAGCAGTCCTCAAAGAGGCAAGTCAGATGGGGCATAGTTCTTCCTCAGACACTGACATTAATGAACCACAGATGAATCATAAAGGTAAAACAGGGAAAGATGATAATGGAAAAAGGAAACGGAAAAATTCTACTTCCGGGTCAGATTTTGACACTAAAAAAGGAAAATCAACAGAAACCTCTATTATCTCTAAAAAGAAACGCCAGAACTACTCAGAGTCCTCTAACTATGACTCAGAGTTAGAGAGAGAGATAAAAACCATGAGCAGAATTGGGGCTGCCAGAAAAAGTGTTCCAGAGAAAAAAGAAGAGGACTCTTCTGAAGATGAAAAACAGGGCAAAAAAGTAGTGGATAATGGAGGGCATGAGAGGGCGAAGACAACACAAGAAGGGTCATCTGCTGATGACACTGGTGACACTGAAGGCAGGCAGGGAGGGAGTTGCTCCATAGCAGGAGGTTCCATTGAGAAAGTCAGGAGTGGAGTGGAATTCCGAGAGATGCTTTGCAAACCTGGTGTTTCCTCTGATGGTGCTGAAAAGCCTTCAGTGAAAGAGGAGAACGTGAATTCCCCTGAAGACAAAAGAGTCTCTAAGACTAAAGAAAAGACTAAACATCTGAGAAGCAGACAAAGTAGAAAAGGAAAGGGTGGGTCATCTGATGGCACTGATCGATTTCCAAAGAAAGAGCAGAGCGATGAGTCTTCTGAAGGCGAAAAGAAGCAGAGCAGACAGAGACCTGGAACAAAAGGAAAGAAAGCCCCAGACTTAAAGGGAGAAACACTGAAGCGAGAGCAGGAGTGGGACTCTTCCTCTGATGGGACCGAGAGATTGCCGGAGGAAGAGGAGATTGGTCCTTTTTCTAAAGGCATAAAGCAAAGTAAAACTGACACAGCTGGTGGAGAAAAGAAAGGCAAAAAATGGAAAGATAAATCATGTGAAAAGAAGGAAGAATTATCTGATAGTGTTGATAAATTGCCAGGAAAAGGAGATAGTTGTGACTCTTCCGAAGATAAGAAGACCAGGAACAGAGTGTCTCTGAGAGAGAAGAAACGATTCAGCTTGCCTGCAAAGAGTCCAGGGAAGAGGCCAGAGTGTTCATCGTCAGATACTGAGAAATCCTTGAAAGGACAGTGTTGTGACTCCACTGAAAAGAGACCGAAAAGAATTGACTTGAGAGAAAGAAGAAACTCCAGTTCAAAGAGAAATACCAAGGAAGTAAAGAGTGCTTCATCCTCTTCTGATGCTGAGGGAAGCTCAGAAGATAATAAAAAGCAGAAGAAACAAAGAACTTCAGCCAAAAAGAAGACAGGCAATACGAAGGAGAAAAAAAGAAACTCCTTAAGAGCAACTCCTAAAAGGAAGCAAGTAGACATCACTTCTTCATCTTCTGATATAGGAGATGATGATCAGAATTCTGCAGGCGAGGAAAGCAGCGATGAACAGAAAATCAAACCCGTGACTGAAAATCTAGTGCTGCCTTCACACACTGGATTTTGTCAGTCTTCAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

CAGAATTCTGCAGGCGAGGA

60.11

AGTCATGAAGCTTCTGCACCA

59.93

141

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

CAGAATTCTGCAGGCGAGGA

60.11

GTCATGAAGCTTCTGCACCA

58.47

140

PCR template sequence:

CAGAATTCTGCAGGCGAGGAAAGCAGCGATGAACAGAAAATCAAACCCGTGACTGAAAATCTAGTGCTGCCTTCACACACTGGATTTTGTCAGTCTTCAGTGGAAACAAGTTGAGTACATTGGTGCAGAAGCTTCATGACTTCTTAGCACACTCATCAGAAGAATCTGAGGAAACGTGTTCTTCTCCACGACTTGTCATG

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

18

Interacting miRNAs (#binding sites)

mmu-miR-335-3p(5), mmu-miR-200a-3p(2), mmu-miR-141-3p(2), mmu-miR-149-5p(2), mmu-miR-9-5p(1), mmu-miR-7b-5p(1), mmu-miR-29b-3p(1), mmu-miR-29a-3p(1), mmu-miR-29c-3p(1), mmu-miR-328-3p(1), mmu-miR-24-3p(1), mmu-miR-300-3p(1), mmu-miR-673-5p(1), mmu-miR-5101(1), mmu-miR-369-3p(1), mmu-miR-532-5p(1), mmu-miR-1199-5p(1), mmu-miR-7a-1-3p(1)

siRNAs for circular RNA silencing
Junction sequence

TGTCAGTCTTCAGTGGAAACAAGTTG

siRNA sets

AACTTGTTTCCACTGAAGA, ACTTGTTTCCACTGAAGAC, CTTGTTTCCACTGAAGACT

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCATRX_3653_ORF_1

0.9984

0.105332824

1

3570

ORF sequence:

ATGAACCAAAGCACAGATAAAATCTGTGGTTCTGGACTTAATTCTGATATGATGGAAAATAACAAGGAAGAGGGAGCTAGCACCTCAGAAAAATCCAGATCTTCAGGTTCATCAAGGTCAAAGAGGAAACCTTCAATTGTGACAAAATATGTAGAATCTGATGATGAAAAACCCACGGATGAGAATGTAAATGAAAAAGCTGCTACTGAGAATTCAGAAAATGACATTACTATGCAAAGCTTGCCAAAAGGTACAGTGATTGTACAACCAGAGCCAGTGCTGAATGAAGACAAAGATGATTTTAAAGGGCCTGAATTTAGAAGCAGAAGTAAAATGAAAGCTGACAATCTCAAAAAACGCGGAGAAGATGGACTTCATGGGATCGTGAGCTGCACAGCTTGTGGACAGCAGGTCAATCATTTTCAAAAAGATTCCATTTATAGACACCCTTCACTCAAAGTCCTTATCTGTAAGAACTGCTTTAAGTATTATATGAGTGACGATATTAGCCGTGACTCAGATGGAATGGATGAACAATGTAGATGGTGTGCAGAAGGTGGGAACTTGATTTGTTGTGACTTTTGTCATAACGCCTTCTGTAAGAAATGCATCCTGCGCAACCTTGGTCGAAAGGAGTTGTCTACAATAATGGATGAAAACAATCAGTGGTATTGCTATATTTGTCAACCAGAGCCTCTACTGGACTTGGTGACTGCGTGCAACAGCGTATTTGAGAATTTAGAACAGTTGTTGCAACAGAATAAGAAGAAGATAAAAGTTGACAGTGAAAAGACTAGTAAAGTCTGTGACCAAACATCCAAATTTTCTCCAAAGAAGAGTAGTTCTAGTTGTAATGGAGAAGAAAAAAAGTTAGAGGAGTCCTGTTCTGGTTCTGTAAGCTCCACTTACTCTCACTCAGCACTATCTGTGCCCAAAGAGATGATTAAGAAGACAACAAAACTGATTGAGACTACATCCAACATGAACTCCAGTTACATTAAGTTTCTAAAACAGGCAGCAGATAATTCAGAAATGACTTCTGCTATGAAGTTATGTCAACTTAAGTCTTTTAAATCTGTGTTGGATGATATCAAGAAGGCTCATCTTGCATTAGAAGAAGATTTGAATTCAGAGATCCAAGCTTTGGATGATGTACACAAAGAAAAAAATACCAAAGACCTTAAAAGCACAGATGCTAAGTCTGAAACAAAATTAGGAAAAGGGGAAAAATCCTATTCTACAGAAAAGAGAGAGTTTTTAAAGTTAGATGCTAGATCATCAGTAAAGGCCATAGATGGTGAAGAGCAGAGAGCACACAAAAGTACTAGTGGGGAACATAAGGGTTCAGGTAGGAAAGATGGCTCTCAGTATGAACCCACTAACACTCCTGAGGATTTAGATATGGATATTGTGTCTGTTCCTTCCTCGGTTCCAGAAGACATTTTTGATAGCCTTGAGAGTGCTATGGAAGTTCAGAGTTCAGCTGATTATCAAGGAGACGGCAACAGTGGGACTGAGCCAGAACTGGAGAGCTCCTCTGTAAAATTAAATGTTTCTTCAAAAGACAGCAGAGGAAATATTAAGTCAAAAGTCACAGCGAAAGTAAGAAAAGAATTATTTGTTAAACTTACCCCAGTTTCCCTTTCTAATTCCCCAATTAAAGGTGTTGACTGTCAGGAAGTGTCACAAGAGAAGAATGGCCGTAAAAGTTCTGGGGTGGCCCGCAGCTCAGAGAAATGTAGACCCAGAGAGGAAATTAGTGATCATGAAAACAATGTCACAATACTTTTAGAAGACTCCGATCTTCGAAGATCCCCACGTGTAAAAACTACACCGTTGAGGCGACAGACAGAAAGCAACCCTGCAATGTCGAATTCAGATGAAGAAAGTAATGGAACTATGAAGGAGAAACAAAAGATGTCAGGTCCAATAAGAAAAAAGGATAAGAGAAACTCAGCTGACTGTGCTACTGATAACCCTAAACCTCACAAGGTACCCAAAGCTAAGCAACCAGTGATTGGGGATCAGAATTCAGATTCTGATGAAATGCTAGCAGTCCTCAAAGAGGCAAGTCAGATGGGGCATAGTTCTTCCTCAGACACTGACATTAATGAACCACAGATGAATCATAAAGGTAAAACAGGGAAAGATGATAATGGAAAAAGGAAACGGAAAAATTCTACTTCCGGGTCAGATTTTGACACTAAAAAAGGAAAATCAACAGAAACCTCTATTATCTCTAAAAAGAAACGCCAGAACTACTCAGAGTCCTCTAACTATGACTCAGAGTTAGAGAGAGAGATAAAAACCATGAGCAGAATTGGGGCTGCCAGAAAAAGTGTTCCAGAGAAAAAAGAAGAGGACTCTTCTGAAGATGAAAAACAGGGCAAAAAAGTAGTGGATAATGGAGGGCATGAGAGGGCGAAGACAACACAAGAAGGGTCATCTGCTGATGACACTGGTGACACTGAAGGCAGGCAGGGAGGGAGTTGCTCCATAGCAGGAGGTTCCATTGAGAAAGTCAGGAGTGGAGTGGAATTCCGAGAGATGCTTTGCAAACCTGGTGTTTCCTCTGATGGTGCTGAAAAGCCTTCAGTGAAAGAGGAGAACGTGAATTCCCCTGAAGACAAAAGAGTCTCTAAGACTAAAGAAAAGACTAAACATCTGAGAAGCAGACAAAGTAGAAAAGGAAAGGGTGGGTCATCTGATGGCACTGATCGATTTCCAAAGAAAGAGCAGAGCGATGAGTCTTCTGAAGGCGAAAAGAAGCAGAGCAGACAGAGACCTGGAACAAAAGGAAAGAAAGCCCCAGACTTAAAGGGAGAAACACTGAAGCGAGAGCAGGAGTGGGACTCTTCCTCTGATGGGACCGAGAGATTGCCGGAGGAAGAGGAGATTGGTCCTTTTTCTAAAGGCATAAAGCAAAGTAAAACTGACACAGCTGGTGGAGAAAAGAAAGGCAAAAAATGGAAAGATAAATCATGTGAAAAGAAGGAAGAATTATCTGATAGTGTTGATAAATTGCCAGGAAAAGGAGATAGTTGTGACTCTTCCGAAGATAAGAAGACCAGGAACAGAGTGTCTCTGAGAGAGAAGAAACGATTCAGCTTGCCTGCAAAGAGTCCAGGGAAGAGGCCAGAGTGTTCATCGTCAGATACTGAGAAATCCTTGAAAGGACAGTGTTGTGACTCCACTGAAAAGAGACCGAAAAGAATTGACTTGAGAGAAAGAAGAAACTCCAGTTCAAAGAGAAATACCAAGGAAGTAAAGAGTGCTTCATCCTCTTCTGATGCTGAGGGAAGCTCAGAAGATAATAAAAAGCAGAAGAAACAAAGAACTTCAGCCAAAAAGAAGACAGGCAATACGAAGGAGAAAAAAAGAAACTCCTTAAGAGCAACTCCTAAAAGGAAGCAAGTAGACATCACTTCTTCATCTTCTGATATAGGAGATGATGATCAGAATTCTGCAGGCGAGGAAAGCAGCGATGAACAGAAAATCAAACCCGTGACTGAAAATCTAGTGCTGCCTTCACACACTGGATTTTGTCAGTCTTCAGTGGAAACAAGTTGA

Peptide sequence:

MNQSTDKICGSGLNSDMMENNKEEGASTSEKSRSSGSSRSKRKPSIVTKYVESDDEKPTDENVNEKAATENSENDITMQSLPKGTVIVQPEPVLNEDKDDFKGPEFRSRSKMKADNLKKRGEDGLHGIVSCTACGQQVNHFQKDSIYRHPSLKVLICKNCFKYYMSDDISRDSDGMDEQCRWCAEGGNLICCDFCHNAFCKKCILRNLGRKELSTIMDENNQWYCYICQPEPLLDLVTACNSVFENLEQLLQQNKKKIKVDSEKTSKVCDQTSKFSPKKSSSSCNGEEKKLEESCSGSVSSTYSHSALSVPKEMIKKTTKLIETTSNMNSSYIKFLKQAADNSEMTSAMKLCQLKSFKSVLDDIKKAHLALEEDLNSEIQALDDVHKEKNTKDLKSTDAKSETKLGKGEKSYSTEKREFLKLDARSSVKAIDGEEQRAHKSTSGEHKGSGRKDGSQYEPTNTPEDLDMDIVSVPSSVPEDIFDSLESAMEVQSSADYQGDGNSGTEPELESSSVKLNVSSKDSRGNIKSKVTAKVRKELFVKLTPVSLSNSPIKGVDCQEVSQEKNGRKSSGVARSSEKCRPREEISDHENNVTILLEDSDLRRSPRVKTTPLRRQTESNPAMSNSDEESNGTMKEKQKMSGPIRKKDKRNSADCATDNPKPHKVPKAKQPVIGDQNSDSDEMLAVLKEASQMGHSSSSDTDINEPQMNHKGKTGKDDNGKRKRKNSTSGSDFDTKKGKSTETSIISKKKRQNYSESSNYDSELEREIKTMSRIGAARKSVPEKKEEDSSEDEKQGKKVVDNGGHERAKTTQEGSSADDTGDTEGRQGGSCSIAGGSIEKVRSGVEFREMLCKPGVSSDGAEKPSVKEENVNSPEDKRVSKTKEKTKHLRSRQSRKGKGGSSDGTDRFPKKEQSDESSEGEKKQSRQRPGTKGKKAPDLKGETLKREQEWDSSSDGTERLPEEEEIGPFSKGIKQSKTDTAGGEKKGKKWKDKSCEKKEELSDSVDKLPGKGDSCDSSEDKKTRNRVSLREKKRFSLPAKSPGKRPECSSSDTEKSLKGQCCDSTEKRPKRIDLRERRNSSSKRNTKEVKSASSSSDAEGSSEDNKKQKKQRTSAKKKTGNTKEKKRNSLRATPKRKQVDITSSSSDIGDDDQNSAGEESSDEQKIKPVTENLVLPSHTGFCQSSVETS

IRESfinder result

IRESfinder score

0.539512795

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page