top of page

mmu_circAtp9b_1149

Basic information of circular RNA
PanCircBase ID:

mmu_circAtp9b_1149

mm39_Chr. Position ID:

chr18|80851826|80961093|-

Gene name:

Atp9b

Transcript:

ENSMUST00000091790.5

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

11

Exon/intron indexes:

12,11,10,9,8,7,6,5,4,3,2

Exon/intron offsets:

0,27743,35915,38560,49932,61130,68703,83203,100980,104185,109093

Genomic length:

109267

Exon/intron sizes in nt:

161,77,76,81,95,52,59,109,114,151,174

Flanking exon/introns:

chr18:80838647-80851826|chr18:80961093-80977038

Splice length:

1149

Other database IDs:

CIRCpedia: MMU_CIRCpedia_30625, circAtlas: mmu-Atp9b_0011

circBase: hsa_circ_0048001, circAtlas: hsa-ATP9B_0011, CIRCpedia: HSA_CIRCpedia_24352

Human Ortholog IDs:
Mature spliced Sequence:

GTACCAGCTGGAGGATGAGTCTGCCCATTTGGATGAAATGCCACTGATGATGTCTGAAGAAGGCTTTGAGAATGATGAAAGTGATTACCACACATTACCTCGAGCTAGGATAACACGGAGAAAGAGAGGACTGGAGTGGTTTGTCTGTGGAGGATGGAAGTTCCTCTGTACCAGTTGCTGTGATTGGCTAATAAATGTTTGTCAAAGGAAGAAAGAGCTAAAAGCTCGAACAGTATGGCTTGGATGTCCAGAGAAGTGTGAAGAGAAACATCCTAGGAATTCTATCAAAAATCAGAAATACAATGTATTTACCTTTATACCTGGGGTTTTGTATGAACAATTCAAGTTTTTCTTGAATCTCTATTTTCTGGTAGTGTCCTGCTCACAGTTTGTACCAGCATTGAAAATTGGCTACCTCTACACCTACTGGGCTCCTCTGGGATTTGTTTTGGCCGTTACGATTGCACGTGAAGCGATTGATGAATTTCGACGTTTTCAGCGAGACAAGGAAATGAATTCACAGTTATATAGCAAGCTTACAGTAAGAGGTAAAGTTCAAGTTAAGAGCTCAGACATACAAGTTGGAGACCTCATCATAGTGGAAAAGAACCAAAGAATTCCATCAGATATGGTATTTCTTAGAACTTCAGAGAAAGCAGGTTCATGTTTTATCCGCACGGACCAGCTAGATGGTGAGACTGACTGGAAGCTGAAGGTGGCGGTGAGCTGCACACAACGGCTGCCAGCCCTCGGGGACCTTTTTTCTATCAGTGCCTATGTTTATGCTCAGAAGCCACAACTGGATATTCATAGCTTTGAAGGAACATTTACCAGGGAAGACAGTGATCCTCCCATTCATGAGAGTCTCAGCATAGAGAACACTCTGTGGGCAAGCACTATTGTTGCATCAGGTACTGTAATAGGTGTTGTCATTTATACTGGAAAAGAGACTCGAAGTGTAATGAACACATCCAATCCAAAAAATAAGGTTGGTTTATTGGACCTCGAACTCAATCAGCTGACAAAGGCGCTATTTCTGGCTTTAGTTGTTCTTTCTGTTGTTATGGTAACCTTACAGGGATTTGCAGGCCCATGGTACCGTAATCTTTTTCGGTTCCTCCTTCTCTTTTCCTACATCATTCCCATAAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

TTACAGGGATTTGCAGGCCC

60.32

AGCCTTCTTCAGACATCATCAGT

59.48

142

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

TTACAGGGATTTGCAGGCCC

60.32

GCCTTCTTCAGACATCATCAGTG

59.38

141

PCR template sequence:

TTCTTTCTGTTGTTATGGTAACCTTACAGGGATTTGCAGGCCCATGGTACCGTAATCTTTTTCGGTTCCTCCTTCTCTTTTCCTACATCATTCCCATAAGGTACCAGCTGGAGGATGAGTCTGCCCATTTGGATGAAATGCCACTGATGATGTCTGAAGAAGGCTTTGAGAATGATGAAAGTGATTACCACACATTACCT

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

16

Interacting miRNAs (#binding sites)

mmu-miR-9-5p(1), mmu-let-7a-5p(1), mmu-let-7b-5p(1), mmu-miR-101a-3p(1), mmu-let-7c-5p(1), mmu-miR-101b-3p(1), mmu-let-7d-5p(1), mmu-miR-301b-3p(1), mmu-miR-301a-3p(1), mmu-miR-98-5p(1), mmu-miR-384-3p(1), mmu-miR-466a-5p(1), mmu-miR-1198-5p(1), mmu-miR-673-5p(1), mmu-miR-452-3p(1), mmu-miR-7a-1-3p(1)

siRNAs for circular RNA silencing
Junction sequence

TCATTCCCATAAGGTACCAGCTGGAG

siRNA sets

TCCAGCTGGTACCTTATGG, CAGCTGGTACCTTATGGGA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCATP9B_1149_ORF_1

0.782

0.011991054

0.999996304

2259

ORF sequence:

ATGCCACTGATGATGTCTGAAGAAGGCTTTGAGAATGATGAAAGTGATTACCACACATTACCTCGAGCTAGGATAACACGGAGAAAGAGAGGACTGGAGTGGTTTGTCTGTGGAGGATGGAAGTTCCTCTGTACCAGTTGCTGTGATTGGCTAATAAATGTTTGTCAAAGGAAGAAAGAGCTAAAAGCTCGAACAGTATGGCTTGGATGTCCAGAGAAGTGTGAAGAGAAACATCCTAGGAATTCTATCAAAAATCAGAAATACAATGTATTTACCTTTATACCTGGGGTTTTGTATGAACAATTCAAGTTTTTCTTGAATCTCTATTTTCTGGTAGTGTCCTGCTCACAGTTTGTACCAGCATTGAAAATTGGCTACCTCTACACCTACTGGGCTCCTCTGGGATTTGTTTTGGCCGTTACGATTGCACGTGAAGCGATTGATGAATTTCGACGTTTTCAGCGAGACAAGGAAATGAATTCACAGTTATATAGCAAGCTTACAGTAAGAGGTAAAGTTCAAGTTAAGAGCTCAGACATACAAGTTGGAGACCTCATCATAGTGGAAAAGAACCAAAGAATTCCATCAGATATGGTATTTCTTAGAACTTCAGAGAAAGCAGGTTCATGTTTTATCCGCACGGACCAGCTAGATGGTGAGACTGACTGGAAGCTGAAGGTGGCGGTGAGCTGCACACAACGGCTGCCAGCCCTCGGGGACCTTTTTTCTATCAGTGCCTATGTTTATGCTCAGAAGCCACAACTGGATATTCATAGCTTTGAAGGAACATTTACCAGGGAAGACAGTGATCCTCCCATTCATGAGAGTCTCAGCATAGAGAACACTCTGTGGGCAAGCACTATTGTTGCATCAGGTACTGTAATAGGTGTTGTCATTTATACTGGAAAAGAGACTCGAAGTGTAATGAACACATCCAATCCAAAAAATAAGGTTGGTTTATTGGACCTCGAACTCAATCAGCTGACAAAGGCGCTATTTCTGGCTTTAGTTGTTCTTTCTGTTGTTATGGTAACCTTACAGGGATTTGCAGGCCCATGGTACCGTAATCTTTTTCGGTTCCTCCTTCTCTTTTCCTACATCATTCCCATAAGGTACCAGCTGGAGGATGAGTCTGCCCATTTGGATGAAATGCCACTGATGATGTCTGAAGAAGGCTTTGAGAATGATGAAAGTGATTACCACACATTACCTCGAGCTAGGATAACACGGAGAAAGAGAGGACTGGAGTGGTTTGTCTGTGGAGGATGGAAGTTCCTCTGTACCAGTTGCTGTGATTGGCTAATAAATGTTTGTCAAAGGAAGAAAGAGCTAAAAGCTCGAACAGTATGGCTTGGATGTCCAGAGAAGTGTGAAGAGAAACATCCTAGGAATTCTATCAAAAATCAGAAATACAATGTATTTACCTTTATACCTGGGGTTTTGTATGAACAATTCAAGTTTTTCTTGAATCTCTATTTTCTGGTAGTGTCCTGCTCACAGTTTGTACCAGCATTGAAAATTGGCTACCTCTACACCTACTGGGCTCCTCTGGGATTTGTTTTGGCCGTTACGATTGCACGTGAAGCGATTGATGAATTTCGACGTTTTCAGCGAGACAAGGAAATGAATTCACAGTTATATAGCAAGCTTACAGTAAGAGGTAAAGTTCAAGTTAAGAGCTCAGACATACAAGTTGGAGACCTCATCATAGTGGAAAAGAACCAAAGAATTCCATCAGATATGGTATTTCTTAGAACTTCAGAGAAAGCAGGTTCATGTTTTATCCGCACGGACCAGCTAGATGGTGAGACTGACTGGAAGCTGAAGGTGGCGGTGAGCTGCACACAACGGCTGCCAGCCCTCGGGGACCTTTTTTCTATCAGTGCCTATGTTTATGCTCAGAAGCCACAACTGGATATTCATAGCTTTGAAGGAACATTTACCAGGGAAGACAGTGATCCTCCCATTCATGAGAGTCTCAGCATAGAGAACACTCTGTGGGCAAGCACTATTGTTGCATCAGGTACTGTAATAGGTGTTGTCATTTATACTGGAAAAGAGACTCGAAGTGTAATGAACACATCCAATCCAAAAAATAAGGTTGGTTTATTGGACCTCGAACTCAATCAGCTGACAAAGGCGCTATTTCTGGCTTTAGTTGTTCTTTCTGTTGTTATGGTAACCTTACAGGGATTTGCAGGCCCATGGTACCGTAATCTTTTTCGGTTCCTCCTTCTCTTTTCCTACATCATTCCCATA

Peptide sequence:

MPLMMSEEGFENDESDYHTLPRARITRRKRGLEWFVCGGWKFLCTSCCDWLINVCQRKKELKARTVWLGCPEKCEEKHPRNSIKNQKYNVFTFIPGVLYEQFKFFLNLYFLVVSCSQFVPALKIGYLYTYWAPLGFVLAVTIAREAIDEFRRFQRDKEMNSQLYSKLTVRGKVQVKSSDIQVGDLIIVEKNQRIPSDMVFLRTSEKAGSCFIRTDQLDGETDWKLKVAVSCTQRLPALGDLFSISAYVYAQKPQLDIHSFEGTFTREDSDPPIHESLSIENTLWASTIVASGTVIGVVIYTGKETRSVMNTSNPKNKVGLLDLELNQLTKALFLALVVLSVVMVTLQGFAGPWYRNLFRFLLLFSYIIPIRYQLEDESAHLDEMPLMMSEEGFENDESDYHTLPRARITRRKRGLEWFVCGGWKFLCTSCCDWLINVCQRKKELKARTVWLGCPEKCEEKHPRNSIKNQKYNVFTFIPGVLYEQFKFFLNLYFLVVSCSQFVPALKIGYLYTYWAPLGFVLAVTIAREAIDEFRRFQRDKEMNSQLYSKLTVRGKVQVKSSDIQVGDLIIVEKNQRIPSDMVFLRTSEKAGSCFIRTDQLDGETDWKLKVAVSCTQRLPALGDLFSISAYVYAQKPQLDIHSFEGTFTREDSDPPIHESLSIENTLWASTIVASGTVIGVVIYTGKETRSVMNTSNPKNKVGLLDLELNQLTKALFLALVVLSVVMVTLQGFAGPWYRNLFRFLLLFSYIIPI

IRESfinder result

IRESfinder score

0.698386009

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page