top of page

mmu_circAtp8b5_781

Basic information of circular RNA
PanCircBase ID:

mmu_circAtp8b5_781

mm39_Chr. Position ID:

chr4|43320591|43344473|+

Gene name:

Atp8b5

Transcript:

ENSMUST00000107942.9

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

6

Exon/intron indexes:

10,11,12,13,14,15

Exon/intron offsets:

0,1818,4248,13553,21845,23838

Genomic length:

23882

Exon/intron sizes in nt:

83,159,89,197,209,44

Flanking exon/introns:

chr4:43311966-43320591|chr4:43344473-43353546

Splice length:

781

Other database IDs:

circAtlas: mmu-Atp8b5_0027

Human Ortholog IDs:
Mature spliced Sequence:

TGAAACCAACCTGAAAGTGAAGCAAGCCATCTCCGTCACCAGTGCCATGGAGGACAACCTGGAGCTGCTGTCCTCCTTTAATGGAGAAGTTAGGTGTGATCCTCCTAATAACAAGCTGGACAAGTTTTCTGGAACCCTGAGCTACCTGGGGAACACCTACTTACTGAACCATGAAAGGCTACTGCTCCGAGGCTGCGTCATCCGGAACACAGACTGGTGCTACGGTTTGGTCGTTTACACTGGGCAAGACACCAAATTAATGCAGAACAGTGGACGGTCCACCTTCAAACGAACACATATAGATCATCTCATGAATGTCCTTGTGGTCTGGATTTTCATGTTTTTAGGTGGAATGTGTTTTCTGCTGTCGATTGGACATGGCATCTGGGAGAACAGCAGAGGCTACTATTTCCAGGCCTTTCTCCCATGGAAACATTATATTACCTCATCGGCTACGAGTTCTGCCCTCATTTTCTGGTCCTACTTCATAGTGCTCAACACCATGGTACCCATTTCCCTCTATGTCAGTGTGGAAATAATAAGACTGGGCAACAGTTACTACATCAACTGGGATCGAAAGATGTTTTACGCCCCAAAGAACATGCCAGCGCAGGCTCGCACCACCACTCTTAATGAGGAGCTGGGCCAAGTCCAATACGTGTTCTCTGACAAAACAGGAACCCTGACTGAGAATGTGATGATTTTCAACAAATGTTCTATCAACGGGAAGACCTATGGTTATTCCTACGACGACAATGGAGAGTATGTGCCAAAATCTCCA

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

TCAACGGGAAGACCTATGGT

58.05

TAAAGGAGGACAGCAGCTCC

59.09

142

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

TCAACGGGAAGACCTATGGT

58.05

AAAGGAGGACAGCAGCTCCA

61.13

141

PCR template sequence:

CCTGACTGAGAATGTGATGATTTTCAACAAATGTTCTATCAACGGGAAGACCTATGGTTATTCCTACGACGACAATGGAGAGTATGTGCCAAAATCTCCATGAAACCAACCTGAAAGTGAAGCAAGCCATCTCCGTCACCAGTGCCATGGAGGACAACCTGGAGCTGCTGTCCTCCTTTAATGGAGAAGTTAGGTGTGAT

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

11

Interacting miRNAs (#binding sites)

mmu-miR-199a-5p(1), mmu-miR-135a-5p(1), mmu-miR-29b-3p(1), mmu-miR-29a-3p(1), mmu-miR-29c-3p(1), mmu-miR-23a-3p(1), mmu-miR-181b-5p(1), mmu-miR-96-5p(1), mmu-miR-183-5p(1), mmu-miR-383-5p(1), mmu-miR-181d-5p(1)

siRNAs for circular RNA silencing
Junction sequence

GCCAAAATCTCCATGAAACCAACCTG

siRNA sets

GTTTCATGGAGATTTTGGC, GGTTTCATGGAGATTTTGG

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCATP8B5_781_ORF_1

0.9342

0.237272453

0.967794206

828

ORF sequence:

ATGGTTATTCCTACGACGACAATGGAGAGTATGTGCCAAAATCTCCATGAAACCAACCTGAAAGTGAAGCAAGCCATCTCCGTCACCAGTGCCATGGAGGACAACCTGGAGCTGCTGTCCTCCTTTAATGGAGAAGTTAGGTGTGATCCTCCTAATAACAAGCTGGACAAGTTTTCTGGAACCCTGAGCTACCTGGGGAACACCTACTTACTGAACCATGAAAGGCTACTGCTCCGAGGCTGCGTCATCCGGAACACAGACTGGTGCTACGGTTTGGTCGTTTACACTGGGCAAGACACCAAATTAATGCAGAACAGTGGACGGTCCACCTTCAAACGAACACATATAGATCATCTCATGAATGTCCTTGTGGTCTGGATTTTCATGTTTTTAGGTGGAATGTGTTTTCTGCTGTCGATTGGACATGGCATCTGGGAGAACAGCAGAGGCTACTATTTCCAGGCCTTTCTCCCATGGAAACATTATATTACCTCATCGGCTACGAGTTCTGCCCTCATTTTCTGGTCCTACTTCATAGTGCTCAACACCATGGTACCCATTTCCCTCTATGTCAGTGTGGAAATAATAAGACTGGGCAACAGTTACTACATCAACTGGGATCGAAAGATGTTTTACGCCCCAAAGAACATGCCAGCGCAGGCTCGCACCACCACTCTTAATGAGGAGCTGGGCCAAGTCCAATACGTGTTCTCTGACAAAACAGGAACCCTGACTGAGAATGTGATGATTTTCAACAAATGTTCTATCAACGGGAAGACCTATGGTTATTCCTACGACGACAATGGAGAGTATGTGCCAAAATCTCCA

Peptide sequence:

MVIPTTTMESMCQNLHETNLKVKQAISVTSAMEDNLELLSSFNGEVRCDPPNNKLDKFSGTLSYLGNTYLLNHERLLLRGCVIRNTDWCYGLVVYTGQDTKLMQNSGRSTFKRTHIDHLMNVLVVWIFMFLGGMCFLLSIGHGIWENSRGYYFQAFLPWKHYITSSATSSALIFWSYFIVLNTMVPISLYVSVEIIRLGNSYYINWDRKMFYAPKNMPAQARTTTLNEELGQVQYVFSDKTGTLTENVMIFNKCSINGKTYGYSYDDNGEYVPKSP

IRESfinder result

IRESfinder score

0.543645038

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page