top of page

mmu_circAtm_4741

Basic information of circular RNA
PanCircBase ID:

mmu_circAtm_4741

mm39_Chr. Position ID:

chr9|53352973|53402340|-

Gene name:

Atm

Transcript:

ENSMUST00000118282.9

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

34

Exon/intron indexes:

60,59,58,57,56,55,54,53,52,51,50,49,48,47,46,45,44,43,42,41,40,39,38,37,36,35,34,33,32,31,30,29,28,27

Exon/intron offsets:

0,733,2318,3671,6379,8844,9875,11679,11858,12615,13042,14094,14820,15704,17129,18039,19217,20807,22479,23358,23552,26291,29678,31942,37907,38900,40628,42399,44335,45140,46232,46876,48437,49240

Genomic length:

49367

Exon/intron sizes in nt:

64,115,87,166,150,117,141,83,139,159,114,208,215,114,174,235,120,105,149,103,89,88,156,88,178,177,142,172,96,133,165,172,200,127

Flanking exon/introns:

chr9:53351467-53352973|chr9:53402340-53403540

Splice length:

4741

Other database IDs:

circAtlas: mmu-Atm_0022

Human Ortholog IDs:
Mature spliced Sequence:

GGATTTGGATCCTGCCCCCAACCCGCCATATTTCCCCTCACATGTCATTCAGGCAACGTTTGCTTACATCAGCAACTGTCATAAAACCAAGTTTAAAAGCATTCTAGAAATTCTTTCTAAAATCCCCGATTCCTATCAGAAAATACTTCTGGCCATTTGTGAACAAGCAGCTGAGACAAATAATGTCTTTAAAAAGCACAGAATTCTTAAAATATATCACCTGTTTGTTAGTTTATTACTGAAAGATATACAGAGTGGCCTGGGAGGGGCTTGGGCCTTTGTCCTTCGCGATGTTATTTATACTCTGATTCACTACATCAACAAAAGGTCTTCTCATTTCACAGATGTGTCGTTGCGTAGCTTTTCCCTTTGCTGTGACCTATTAAGTCGAGTTTGTCATACAGCTGTAACTCAATGTAAGGATGCTCTAGAAAGCCATCTTCACGTTATCGTTGGCACACTTATTCCCCTTGTGGATTATCAGGAAGTTCAAGAACAGGTATTGGACCTGTTGAAGTACTTAGTGATAGATAACAAAGACAATAAAAACCTCTCTGTCACAATTAAGCTTTTGGATCCCTTTCCTGACCATGTTATTTTTAAGGACTTGCGTCTTACTCAACAGAAAATCAAATATAGTGGAGGACCTTTTTCACTCTTAGAGGAAATAAACCATTTTCTCTCAGTAAGTGCTTACAATCCACTTCCGCTGACCAGGCTTGAAGGACTGAAGGATCTTCGAAGACAACTGGAGCAACATAAAGATCAGATGCTAGATCTTCTGAGAGCGTCTCAAGATAACCCACAAGATGGCATTGTGGTGAAGCTAGTTGTCAGCTTGTTGCAGTTATCCAAGATGGCAGTGAACCAGACTGGTGAAAGAGAAGTTTTAGAGGCTGTCGGAAGGTGTTTGGGAGAAATAGGTCCTCTGGATTTCTCCACCATAGCTGTCCAGCATAACAAAGATGTGTCCTATACCAAAGCCTACGGGTTACCTGAAGACAGAGAACTTCAGTGGACCTTGATAATGCTGACTGCCCTCAACAATACCCTGGTAGAGGACAGTGTCAAAATTCGATCTGCTGCTGCTACCTGTTTGAAAAACATTTTGGCTACAAAGATTGGACATATTTTCTGGGAGAATTATAAGACATCAGCGGATCCAATGCTGACCTATCTACAACCTTTTAGAACATCGAGGAAAAAGTTTTTAGAAGTGCCCCGATCTGTTAAAGAAGATGTTTTAGAAGGCCTGGATGCTGTGAATCTGTGGGTTCCTCAAAGTGAAAGTCATGACATTTGGATAAAGACACTGACGTGTGCCTTTCTGGACAGTGGAGGCATAAACAGTGAAATTCTCCAGTTATTAAAGCCAATGTGTGAAGTGAAAACCGACTTCTGTCAGATGTTGCTGCCATACTTGATCCATGATGTTTTACTGCAAGATACACATGAATCGTGGAGAACTCTGCTGTCTGCGCACGTCCGAGGATTTTTCACTAGTTGTTTTAAGCATTCCTCCCAAGCAAGCCGCTCAGCAACTCCTGCAAATTCGGATTCAGAGTCAGAGAACTTTCTCCGATGCTGTTTGGATAAAAAGTCACAAAGAACCATGCTTGCTGTTGTCGACTATCTGAGAAGGCAAAAGAGACCTTCCTCGGGAACAGCTTTTGATGACGCTTTCTGGCTGGATTTGAATTATCTTGAGGTTGCGAAGGTGGCTCAGTCCTGCTCTGCTCACTTCACGGCCTTGCTCTACGCAGAGATCTATTCAGATAAGAAAAGCACAGACGAGCAAGAGAAAAGAAGTCCAACATTTGAAGAAGGAAGTCAAGGAACAACTATTTCTAGTTTGAGTGAAAAAAGTAAAGAAGAAACTGGAATAAGCTTACAGGATCTTCTCTTAGAGATCTACAGAAGTATAGGAGAGCCGGACAGCCTGTATGGCTGTGGAGGAGGGAAAATGTTACAACCCCTTACTAGAATACGGACATATGAACATGAAGCTACGTGGGAGAAAGCCTTAGTAACTTACGACCTGGAGACCAGCATCTCCTCCTCCACCCGCCAGTCAGGAATCATCCAGGCCCTGCAGAATTTGGGGCTCTCCCATATCCTGTCTGTCTATCTGAAAGGATTAGACTATGAAAGACGAGAGTGGTGCGCTGAGCTGCAGGAGCTGCGTTACCAGGCGGCGTGGAGGAACATGCAGTGGGGCCTCTGCGCTTCTGCCGGCCAAGAAGTAGAAGGAACCAGTTACCATGAATCGTTGTATAATGCTCTGCAGTGTCTAAGAAACAGAGAATTCTCCACATTTTATGAAAGTCTCCGATATGCCAGGGTGAAAGAAGTTGAAGAGTTGAGTAAGGGCAGCCTTGAGTCTGTATATTCGCTGTATCCCACACTTAGTAGATTGCAGGCAATTGGAGAACTGGAAAACAGTGGCGAGCTTTTCTCAAGGTCAGTCACAGACAGAGAGCGCTCTGAAGCATACTGGAAGTGGCAGAAGCACTCCCAGCTTCTGAAAGACAGCGACTTCAGCTTTCAGGAGCCTCTCATGGCTCTGCGCACAGTCATTCTGGAGACCCTGGTACAGAAGGAAATGGAGCGCTCTCAAGGAGCATGCTCTAAGGACATTCTCACCAAACACCTCGTTGAATTCTCTGTTCTGGCTCGAACCTTCAAGAACACACAGCTCCCTGAAAGAGCAATATTCAAAATTAAGCAATATAATTCAGCTATTTGTGGAATTTCTGAGTGGCATTTGGAAGAAGCACAAGTATTCTGGGCAAAAAAGGAGCAGAGTCTTGCTCTGAGTATTCTCAAGCAGATGATCAAGAAGTTGGACTCCAGCTTTAAAGATAAAGAGAATGATGCAGGTCTCAAAGTCATATACGCAGAGTGTCTGAGGGTTTGTGGCAGCTGGCTGGCAGAAACTTGCTTAGAAAACCCTGCAGTCATCATGCAGACCTATCTAGAAAAGGCGGTGAAGGTTGCTGGAAGTTACGATGGCAACAGCAGAGAGCTCAGAAATGGACAGATGAAGGCCTTTCTCTCGTTGGCAAGGTTCTCTGATACTCAGTACCAGAGAATTGAAAACTACATGAAGTCATCAGAATTTGAAAACAAGCAAACTCTCTTAAAAAGAGCCAAAGAGGAAGTGGGCCTTCTAAGGGAACATAAAATTCAGACCAACAGATACACAGTAAAGGTTCAGCGAGAACTGGAGCTGGACGAATGTGCTCTCCGTGCACTGAGAGAGGATCGCAAGCGCTTCCTGTGTAAAGCAGTGGAGAACTACATCAACTGCTTACTAAGCGGGGAAGAACATGATCTGTGGGTGTTCCGGCTTTGCTCCCTCTGGCTTGAAAATTCTGGAGTTTCTGAAGTCAATGGCATGATGAAGAAAGATGGAATGAAGATTTCATCCTATAAGTTTTTGCCTCTCATGTATCAATTGGCTGCTCGAATGGGGACCAAAATGACGGGAGGCCTAGGATTTCACGAAGTCCTCAATAATCTAATCTCTAGGATTTCACTGGATCACCCCCATCATACTTTGTTCATTATACTGGCCTTAGCAAATGCGAACAAAGATGAATTTTTGAGCAAACCAGAGACAACAAGAAGGAGTCGAATAACCAAAAGTACATCTAAAGAAAACTCTCACCTTGATGAGGATCGAACAGAGGCTGCAACCAGAATCATCCACTCCATCAGAAGTAAGCGATGTAAGATGGTGAAGGACATGGAGGCGCTCTGCGATGCCTACATCATCTTGGCAAACATGGACGCCTCTCAGTGGAGGGCTCAGAGAAAAGGCATCAATATTCCAGCCAACCAGCCAATCACTAAACTGAAGAATTTAGAAGATGTTGTTGTTCCCACTATGGAAATTAAGGTTGATCCCACAGGAGAGTATGAAAATCTGGTGACTATAAAATCATTTAAAACAGAATTTCGCTTAGCTGGAGGCTTAAATTTACCCAAAATAATAGATTGTGTGGGTTCTGATGGCAAGGAAAGGAGACAGCTTGTGAAGGGCCGTGATGACCTGAGGCAAGATGCTGTCATGCAGCAGGTCTTCCAGATGTGCAATACACTACTGCAGAGAAACACTGAGACTAGAAAGAGGAAACTGACTATCTGCACATACAAGGTGGTTCCCCTTTCTCAGCGAAGCGGTGTTCTCGAGTGGTGCACAGGAACCGTTCCTATTGGTGAATATCTTGTTAACAGCGAAGACGGTGCACATAGAAGATACAGGCCAAATGATTTCAGTGCCAATCAGTGCCAAAAGAAAATGATGGAAGTGCAGAAGAAGTCTTTTGAAGAGAAATATGATACCTTCATGACGATTTGCCAAAACTTTGAACCAGTTTTCCGTTACTTCTGCATGGAAAAATTCTTGGACCCAGCTGTTTGGTTTGAGAAACGATTGGCATATACACGCAGTGTGGCCACATCTTCTATCGTCGGTTACATCCTTGGACTTGGCGACAGGCACGTACAGAATATCTTGATAAACGAGCAGTCGGCAGAGCTTGTGCACATAGACCTGGGAGTGGCTTTTGAACAGGGGAAGATCCTTCCCACTCCAGAAACAGTTCCTTTTAGACTCAGCAGAGATATTGTGGACGGGATGGGCATCACCGGTGTGGAAGGTGTCTTCAGAAGGTGCTGTGAAAAAACGATGGAAGTTATGCGGAGTTCTCAGGAAACCCTGCTGACCATTGTAGAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

CCGGTGTGGAAGGTGTCTTC

60.6

TGCCTGAATGACATGTGAGGG

60.34

144

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

CCGGTGTGGAAGGTGTCTTC

60.6

GCCTGAATGACATGTGAGGG

58.61

143

PCR template sequence:

GATGGGCATCACCGGTGTGGAAGGTGTCTTCAGAAGGTGCTGTGAAAAAACGATGGAAGTTATGCGGAGTTCTCAGGAAACCCTGCTGACCATTGTAGAGGGATTTGGATCCTGCCCCCAACCCGCCATATTTCCCCTCACATGTCATTCAGGCAACGTTTGCTTACATCAGCAACTGTCATAAAACCAAGTTTAAAAGC

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

36

Interacting miRNAs (#binding sites)

mmu-miR-15b-5p(2), mmu-miR-5101(2), mmu-miR-350-3p(2), mmu-miR-124-3p(1), mmu-miR-137-3p(1), mmu-miR-134-5p(1), mmu-miR-16-5p(1), mmu-miR-15a-5p(1), mmu-miR-32-5p(1), mmu-miR-7b-5p(1), mmu-miR-150-5p(1), mmu-miR-135a-5p(1), mmu-miR-322-5p(1), mmu-miR-152-3p(1), mmu-miR-148b-3p(1), mmu-miR-148a-3p(1), mmu-miR-298-5p(1), mmu-miR-203-3p(1), mmu-miR-320-3p(1), mmu-miR-326-3p(1), mmu-miR-185-5p(1), mmu-miR-495-3p(1), mmu-miR-136-5p(1), mmu-miR-434-5p(1), mmu-miR-96-5p(1), mmu-miR-199b-3p(1), mmu-miR-218-5p(1), mmu-miR-199a-3p(1), mmu-miR-297a-5p(1), mmu-miR-325-3p(1), mmu-miR-673-5p(1), mmu-miR-335-3p(1), mmu-miR-669d-5p(1), mmu-miR-3470b(1), mmu-miR-296-3p(1), mmu-miR-339-3p(1)

siRNAs for circular RNA silencing
Junction sequence

GACCATTGTAGAGGGATTTGGATCCT

siRNA sets

NA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCATM_4741_ORF_1

0.7676

0.143961026

1

4056

ORF sequence:

ATGCTAGATCTTCTGAGAGCGTCTCAAGATAACCCACAAGATGGCATTGTGGTGAAGCTAGTTGTCAGCTTGTTGCAGTTATCCAAGATGGCAGTGAACCAGACTGGTGAAAGAGAAGTTTTAGAGGCTGTCGGAAGGTGTTTGGGAGAAATAGGTCCTCTGGATTTCTCCACCATAGCTGTCCAGCATAACAAAGATGTGTCCTATACCAAAGCCTACGGGTTACCTGAAGACAGAGAACTTCAGTGGACCTTGATAATGCTGACTGCCCTCAACAATACCCTGGTAGAGGACAGTGTCAAAATTCGATCTGCTGCTGCTACCTGTTTGAAAAACATTTTGGCTACAAAGATTGGACATATTTTCTGGGAGAATTATAAGACATCAGCGGATCCAATGCTGACCTATCTACAACCTTTTAGAACATCGAGGAAAAAGTTTTTAGAAGTGCCCCGATCTGTTAAAGAAGATGTTTTAGAAGGCCTGGATGCTGTGAATCTGTGGGTTCCTCAAAGTGAAAGTCATGACATTTGGATAAAGACACTGACGTGTGCCTTTCTGGACAGTGGAGGCATAAACAGTGAAATTCTCCAGTTATTAAAGCCAATGTGTGAAGTGAAAACCGACTTCTGTCAGATGTTGCTGCCATACTTGATCCATGATGTTTTACTGCAAGATACACATGAATCGTGGAGAACTCTGCTGTCTGCGCACGTCCGAGGATTTTTCACTAGTTGTTTTAAGCATTCCTCCCAAGCAAGCCGCTCAGCAACTCCTGCAAATTCGGATTCAGAGTCAGAGAACTTTCTCCGATGCTGTTTGGATAAAAAGTCACAAAGAACCATGCTTGCTGTTGTCGACTATCTGAGAAGGCAAAAGAGACCTTCCTCGGGAACAGCTTTTGATGACGCTTTCTGGCTGGATTTGAATTATCTTGAGGTTGCGAAGGTGGCTCAGTCCTGCTCTGCTCACTTCACGGCCTTGCTCTACGCAGAGATCTATTCAGATAAGAAAAGCACAGACGAGCAAGAGAAAAGAAGTCCAACATTTGAAGAAGGAAGTCAAGGAACAACTATTTCTAGTTTGAGTGAAAAAAGTAAAGAAGAAACTGGAATAAGCTTACAGGATCTTCTCTTAGAGATCTACAGAAGTATAGGAGAGCCGGACAGCCTGTATGGCTGTGGAGGAGGGAAAATGTTACAACCCCTTACTAGAATACGGACATATGAACATGAAGCTACGTGGGAGAAAGCCTTAGTAACTTACGACCTGGAGACCAGCATCTCCTCCTCCACCCGCCAGTCAGGAATCATCCAGGCCCTGCAGAATTTGGGGCTCTCCCATATCCTGTCTGTCTATCTGAAAGGATTAGACTATGAAAGACGAGAGTGGTGCGCTGAGCTGCAGGAGCTGCGTTACCAGGCGGCGTGGAGGAACATGCAGTGGGGCCTCTGCGCTTCTGCCGGCCAAGAAGTAGAAGGAACCAGTTACCATGAATCGTTGTATAATGCTCTGCAGTGTCTAAGAAACAGAGAATTCTCCACATTTTATGAAAGTCTCCGATATGCCAGGGTGAAAGAAGTTGAAGAGTTGAGTAAGGGCAGCCTTGAGTCTGTATATTCGCTGTATCCCACACTTAGTAGATTGCAGGCAATTGGAGAACTGGAAAACAGTGGCGAGCTTTTCTCAAGGTCAGTCACAGACAGAGAGCGCTCTGAAGCATACTGGAAGTGGCAGAAGCACTCCCAGCTTCTGAAAGACAGCGACTTCAGCTTTCAGGAGCCTCTCATGGCTCTGCGCACAGTCATTCTGGAGACCCTGGTACAGAAGGAAATGGAGCGCTCTCAAGGAGCATGCTCTAAGGACATTCTCACCAAACACCTCGTTGAATTCTCTGTTCTGGCTCGAACCTTCAAGAACACACAGCTCCCTGAAAGAGCAATATTCAAAATTAAGCAATATAATTCAGCTATTTGTGGAATTTCTGAGTGGCATTTGGAAGAAGCACAAGTATTCTGGGCAAAAAAGGAGCAGAGTCTTGCTCTGAGTATTCTCAAGCAGATGATCAAGAAGTTGGACTCCAGCTTTAAAGATAAAGAGAATGATGCAGGTCTCAAAGTCATATACGCAGAGTGTCTGAGGGTTTGTGGCAGCTGGCTGGCAGAAACTTGCTTAGAAAACCCTGCAGTCATCATGCAGACCTATCTAGAAAAGGCGGTGAAGGTTGCTGGAAGTTACGATGGCAACAGCAGAGAGCTCAGAAATGGACAGATGAAGGCCTTTCTCTCGTTGGCAAGGTTCTCTGATACTCAGTACCAGAGAATTGAAAACTACATGAAGTCATCAGAATTTGAAAACAAGCAAACTCTCTTAAAAAGAGCCAAAGAGGAAGTGGGCCTTCTAAGGGAACATAAAATTCAGACCAACAGATACACAGTAAAGGTTCAGCGAGAACTGGAGCTGGACGAATGTGCTCTCCGTGCACTGAGAGAGGATCGCAAGCGCTTCCTGTGTAAAGCAGTGGAGAACTACATCAACTGCTTACTAAGCGGGGAAGAACATGATCTGTGGGTGTTCCGGCTTTGCTCCCTCTGGCTTGAAAATTCTGGAGTTTCTGAAGTCAATGGCATGATGAAGAAAGATGGAATGAAGATTTCATCCTATAAGTTTTTGCCTCTCATGTATCAATTGGCTGCTCGAATGGGGACCAAAATGACGGGAGGCCTAGGATTTCACGAAGTCCTCAATAATCTAATCTCTAGGATTTCACTGGATCACCCCCATCATACTTTGTTCATTATACTGGCCTTAGCAAATGCGAACAAAGATGAATTTTTGAGCAAACCAGAGACAACAAGAAGGAGTCGAATAACCAAAAGTACATCTAAAGAAAACTCTCACCTTGATGAGGATCGAACAGAGGCTGCAACCAGAATCATCCACTCCATCAGAAGTAAGCGATGTAAGATGGTGAAGGACATGGAGGCGCTCTGCGATGCCTACATCATCTTGGCAAACATGGACGCCTCTCAGTGGAGGGCTCAGAGAAAAGGCATCAATATTCCAGCCAACCAGCCAATCACTAAACTGAAGAATTTAGAAGATGTTGTTGTTCCCACTATGGAAATTAAGGTTGATCCCACAGGAGAGTATGAAAATCTGGTGACTATAAAATCATTTAAAACAGAATTTCGCTTAGCTGGAGGCTTAAATTTACCCAAAATAATAGATTGTGTGGGTTCTGATGGCAAGGAAAGGAGACAGCTTGTGAAGGGCCGTGATGACCTGAGGCAAGATGCTGTCATGCAGCAGGTCTTCCAGATGTGCAATACACTACTGCAGAGAAACACTGAGACTAGAAAGAGGAAACTGACTATCTGCACATACAAGGTGGTTCCCCTTTCTCAGCGAAGCGGTGTTCTCGAGTGGTGCACAGGAACCGTTCCTATTGGTGAATATCTTGTTAACAGCGAAGACGGTGCACATAGAAGATACAGGCCAAATGATTTCAGTGCCAATCAGTGCCAAAAGAAAATGATGGAAGTGCAGAAGAAGTCTTTTGAAGAGAAATATGATACCTTCATGACGATTTGCCAAAACTTTGAACCAGTTTTCCGTTACTTCTGCATGGAAAAATTCTTGGACCCAGCTGTTTGGTTTGAGAAACGATTGGCATATACACGCAGTGTGGCCACATCTTCTATCGTCGGTTACATCCTTGGACTTGGCGACAGGCACGTACAGAATATCTTGATAAACGAGCAGTCGGCAGAGCTTGTGCACATAGACCTGGGAGTGGCTTTTGAACAGGGGAAGATCCTTCCCACTCCAGAAACAGTTCCTTTTAGACTCAGCAGAGATATTGTGGACGGGATGGGCATCACCGGTGTGGAAGGTGTCTTCAGAAGGTGCTGTGAAAAAACGATGGAAGTTATGCGGAGTTCTCAGGAAACCCTGCTGACCATTGTAGAGGGATTTGGATCCTGCCCCCAACCCGCCATATTTCCCCTCACATGTCATTCAGGCAACGTTTGCTTACATCAGCAACTGTCATAA

Peptide sequence:

MLDLLRASQDNPQDGIVVKLVVSLLQLSKMAVNQTGEREVLEAVGRCLGEIGPLDFSTIAVQHNKDVSYTKAYGLPEDRELQWTLIMLTALNNTLVEDSVKIRSAAATCLKNILATKIGHIFWENYKTSADPMLTYLQPFRTSRKKFLEVPRSVKEDVLEGLDAVNLWVPQSESHDIWIKTLTCAFLDSGGINSEILQLLKPMCEVKTDFCQMLLPYLIHDVLLQDTHESWRTLLSAHVRGFFTSCFKHSSQASRSATPANSDSESENFLRCCLDKKSQRTMLAVVDYLRRQKRPSSGTAFDDAFWLDLNYLEVAKVAQSCSAHFTALLYAEIYSDKKSTDEQEKRSPTFEEGSQGTTISSLSEKSKEETGISLQDLLLEIYRSIGEPDSLYGCGGGKMLQPLTRIRTYEHEATWEKALVTYDLETSISSSTRQSGIIQALQNLGLSHILSVYLKGLDYERREWCAELQELRYQAAWRNMQWGLCASAGQEVEGTSYHESLYNALQCLRNREFSTFYESLRYARVKEVEELSKGSLESVYSLYPTLSRLQAIGELENSGELFSRSVTDRERSEAYWKWQKHSQLLKDSDFSFQEPLMALRTVILETLVQKEMERSQGACSKDILTKHLVEFSVLARTFKNTQLPERAIFKIKQYNSAICGISEWHLEEAQVFWAKKEQSLALSILKQMIKKLDSSFKDKENDAGLKVIYAECLRVCGSWLAETCLENPAVIMQTYLEKAVKVAGSYDGNSRELRNGQMKAFLSLARFSDTQYQRIENYMKSSEFENKQTLLKRAKEEVGLLREHKIQTNRYTVKVQRELELDECALRALREDRKRFLCKAVENYINCLLSGEEHDLWVFRLCSLWLENSGVSEVNGMMKKDGMKISSYKFLPLMYQLAARMGTKMTGGLGFHEVLNNLISRISLDHPHHTLFIILALANANKDEFLSKPETTRRSRITKSTSKENSHLDEDRTEAATRIIHSIRSKRCKMVKDMEALCDAYIILANMDASQWRAQRKGINIPANQPITKLKNLEDVVVPTMEIKVDPTGEYENLVTIKSFKTEFRLAGGLNLPKIIDCVGSDGKERRQLVKGRDDLRQDAVMQQVFQMCNTLLQRNTETRKRKLTICTYKVVPLSQRSGVLEWCTGTVPIGEYLVNSEDGAHRRYRPNDFSANQCQKKMMEVQKKSFEEKYDTFMTICQNFEPVFRYFCMEKFLDPAVWFEKRLAYTRSVATSSIVGYILGLGDRHVQNILINEQSAELVHIDLGVAFEQGKILPTPETVPFRLSRDIVDGMGITGVEGVFRRCCEKTMEVMRSSQETLLTIVEGFGSCPQPAIFPLTCHSGNVCLHQQLS

IRESfinder result

IRESfinder score

0.596799821

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page