top of page

mmu_circAtad3a_864

Basic information of circular RNA
PanCircBase ID:

mmu_circAtad3a_864

mm39_Chr. Position ID:

chr4|155830485|155836049|-

Gene name:

Atad3a

Transcript:

ENSMUST00000030903.12

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

8

Exon/intron indexes:

15,14,13,12,11,10,9,8

Exon/intron offsets:

0,1285,2642,3128,4103,4444,4839,5408

Genomic length:

5564

Exon/intron sizes in nt:

10,91,68,71,52,12,51,20,00,000

Flanking exon/introns:

chr4:155825809-155830485|chr4:155836049-155838023

Splice length:

864

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTGGCTGGGTTGACACTATTAGCTGTTGGAGTCTATTCTGCAAAGAATGCTACTTCTGTTGCTGGTCGGTATATTGAGGCCCGATTGGGAAAGCCGTCCTTGGTGAGAGAGACCTCCCGAATCTCAGTGCTAGAGGCATTGAGGCATCCCATCCAGGTCAGCAGGCGACTGGTCAGCAGACCCCAGGATGCATTGGAGGGCGTCATCCTCAGTCCTAGCCTGGAGGCACGGGTCCGAGATATTGCCATCGCAACAAGAAATACCAAGAAGAACAAAAGCCTGTATAGGAACGTTCTGATGTATGGGCCCCCGGGGACTGGCAAGACACTATTTGCCAAGAAACTTGCACTGCATTCAGGCATGGACTACGCCATCATGACAGGCGGGGACGTGGCCCCAATGGGGCGGGAGGGTGTGACTGCCATGCACAAGGTCTTCGACTGGGCAAGCACCAGCCGACGAGGCCTCCTGCTCTTTGTGGATGAAGCAGACGCCTTCCTCAGGAAACGAGCGACTGAAAAGATAAGTGAAGACCTCAGGGCTACTCTGAATGCCTTCCTACACAGGACAGGACAGCACAGTAGTAAGTTCATGCTGGTCCTGGCCAGTAACCAGCCTGAGCAGTTTGATTGGGCTATCAATGACCGCATTGACGAGATGGTCTGCTTTGCCCTGCCACAGCGGGAGGAGCGAGAGCGCCTGGTGAGAATGTATTTTGACAAGTATGTCCTTAAGCCGGCCACAGAAGGAAAGCAGCGCTTGAAGGTGGCCCAGTTTGACTATGGAAAGAAATGCTCAGAGGTTGCCCAGCTAACGGAGGGGATGTCAGGCCGGGAGATTGCTCAGCTTGCTGTGGCGTGGCAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

AAATGCTCAGAGGTTGCCCA

59.89

ACCGACCAGCAACAGAAGTAG

60

145

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

AAATGCTCAGAGGTTGCCCA

59.89

GGGCCTCAATATACCGACCAG

60

157

PCR template sequence:

GGTGGCCCAGTTTGACTATGGAAAGAAATGCTCAGAGGTTGCCCAGCTAACGGAGGGGATGTCAGGCCGGGAGATTGCTCAGCTTGCTGTGGCGTGGCAGGTGGCTGGGTTGACACTATTAGCTGTTGGAGTCTATTCTGCAAAGAATGCTACTTCTGTTGCTGGTCGGTATATTGAGGCCCGATTGGGAAAGCCGTCCT

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

9

Interacting miRNAs (#binding sites)

mmu-miR-125b-5p(1), mmu-miR-138-5p(1), mmu-miR-433-3p(1), mmu-miR-125a-5p(1), mmu-miR-676-3p(1), mmu-miR-301b-3p(1), mmu-miR-370-3p(1), mmu-miR-301a-3p(1), mmu-miR-338-3p(1)

siRNAs for circular RNA silencing
Junction sequence

TGTGGCGTGGCAGGTGGCTGGGTTGA

siRNA sets

NA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCATAD3A_864_ORF_1

1.1425

0.3754911

0.99983393

1431

ORF sequence:

ATGTATGGGCCCCCGGGGACTGGCAAGACACTATTTGCCAAGAAACTTGCACTGCATTCAGGCATGGACTACGCCATCATGACAGGCGGGGACGTGGCCCCAATGGGGCGGGAGGGTGTGACTGCCATGCACAAGGTCTTCGACTGGGCAAGCACCAGCCGACGAGGCCTCCTGCTCTTTGTGGATGAAGCAGACGCCTTCCTCAGGAAACGAGCGACTGAAAAGATAAGTGAAGACCTCAGGGCTACTCTGAATGCCTTCCTACACAGGACAGGACAGCACAGTAGTAAGTTCATGCTGGTCCTGGCCAGTAACCAGCCTGAGCAGTTTGATTGGGCTATCAATGACCGCATTGACGAGATGGTCTGCTTTGCCCTGCCACAGCGGGAGGAGCGAGAGCGCCTGGTGAGAATGTATTTTGACAAGTATGTCCTTAAGCCGGCCACAGAAGGAAAGCAGCGCTTGAAGGTGGCCCAGTTTGACTATGGAAAGAAATGCTCAGAGGTTGCCCAGCTAACGGAGGGGATGTCAGGCCGGGAGATTGCTCAGCTTGCTGTGGCGTGGCAGGTGGCTGGGTTGACACTATTAGCTGTTGGAGTCTATTCTGCAAAGAATGCTACTTCTGTTGCTGGTCGGTATATTGAGGCCCGATTGGGAAAGCCGTCCTTGGTGAGAGAGACCTCCCGAATCTCAGTGCTAGAGGCATTGAGGCATCCCATCCAGGTCAGCAGGCGACTGGTCAGCAGACCCCAGGATGCATTGGAGGGCGTCATCCTCAGTCCTAGCCTGGAGGCACGGGTCCGAGATATTGCCATCGCAACAAGAAATACCAAGAAGAACAAAAGCCTGTATAGGAACGTTCTGATGTATGGGCCCCCGGGGACTGGCAAGACACTATTTGCCAAGAAACTTGCACTGCATTCAGGCATGGACTACGCCATCATGACAGGCGGGGACGTGGCCCCAATGGGGCGGGAGGGTGTGACTGCCATGCACAAGGTCTTCGACTGGGCAAGCACCAGCCGACGAGGCCTCCTGCTCTTTGTGGATGAAGCAGACGCCTTCCTCAGGAAACGAGCGACTGAAAAGATAAGTGAAGACCTCAGGGCTACTCTGAATGCCTTCCTACACAGGACAGGACAGCACAGTAGTAAGTTCATGCTGGTCCTGGCCAGTAACCAGCCTGAGCAGTTTGATTGGGCTATCAATGACCGCATTGACGAGATGGTCTGCTTTGCCCTGCCACAGCGGGAGGAGCGAGAGCGCCTGGTGAGAATGTATTTTGACAAGTATGTCCTTAAGCCGGCCACAGAAGGAAAGCAGCGCTTGAAGGTGGCCCAGTTTGACTATGGAAAGAAATGCTCAGAGGTTGCCCAGCTAACGGAGGGGATGTCAGGCCGGGAGATTGCTCAGCTTGCTGTGGCGTGGCAG

Peptide sequence:

MYGPPGTGKTLFAKKLALHSGMDYAIMTGGDVAPMGREGVTAMHKVFDWASTSRRGLLLFVDEADAFLRKRATEKISEDLRATLNAFLHRTGQHSSKFMLVLASNQPEQFDWAINDRIDEMVCFALPQREERERLVRMYFDKYVLKPATEGKQRLKVAQFDYGKKCSEVAQLTEGMSGREIAQLAVAWQVAGLTLLAVGVYSAKNATSVAGRYIEARLGKPSLVRETSRISVLEALRHPIQVSRRLVSRPQDALEGVILSPSLEARVRDIAIATRNTKKNKSLYRNVLMYGPPGTGKTLFAKKLALHSGMDYAIMTGGDVAPMGREGVTAMHKVFDWASTSRRGLLLFVDEADAFLRKRATEKISEDLRATLNAFLHRTGQHSSKFMLVLASNQPEQFDWAINDRIDEMVCFALPQREERERLVRMYFDKYVLKPATEGKQRLKVAQFDYGKKCSEVAQLTEGMSGREIAQLAVAWQ

IRESfinder result

IRESfinder score

0.348211669

IRES/non IRES

non-IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page