top of page

mmu_circAtad2b_907

Basic information of circular RNA
PanCircBase ID:

mmu_circAtad2b_907

mm39_Chr. Position ID:

chr12|4991971|5008231|+

Gene name:

Atad2b

Transcript:

ENSMUST00000045664.7

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

8

Exon/intron indexes:

5,6,7,8,9,10,11,12

Exon/intron offsets:

0,1183,2934,8547,10636,12574,15528,16085

Genomic length:

16260

Exon/intron sizes in nt:

103,109,117,76,99,112,116,175

Flanking exon/introns:

chr12:4990245-4991971|chr12:5008231-5011217

Splice length:

907

Other database IDs:

circAtlas: mmu-Atad2b_0087

circBase: hsa_circ_0119450, circAtlas: hsa-ATAD2B_0088, CIRCpedia: HSA_CIRCpedia_122240

Human Ortholog IDs:
Mature spliced Sequence:

TACTGCTGAAGCTGTATTACAAGAAATGGATAATATTAATATCCGACGAAACCGTCGATCAGGCGAAGTAGAGAGGCTTCGAATGTGGACAGATACAGAATTTGAAAATATGGATATGTATTCAAGGGTAAAAAGACGAAGAAAATCACTGAGAAGAAATAGTTATGGGATACAGAATCATCATGAGGTTTCCACTGAGGGCGAGGAAGAAGAATCTCAAGAGGAGGATGGAGACATAGAGGTTGAAGAGGCAGAAGGAGAAGAAAATGATAGACCATATAACTTGAGACAAAGAAAAACAGTGGATCGATACCAAGCACCGCCTATAGTACCGGCTCATCAAAAAAAGAGGGAAAATACACTATTTGATATTCACAGGTCTCCAGCAAGAAGAAGCCATATCAGGAGAAAGAAACATGCCATTCACAGTAGTGATACAACTTCTTCTGATGAGGAACGCTTTGAAAGAAGGAAATCGAAAAGCATGGCAAGAGCAAGAAACAGATGTTTGCCGATGAACTTCAGAGCAGAAGATTTAGCTAGCGGCATCCTCCGAGAACGGGTGAAAGTGGGTGCAAGTTTGGCTGATGTTGATCCCATGAACATTGATAAATCAGTGCGGTTTGATAGCATAGGTGGATTGAGCCATCATATTCACGCTTTGAAGGAGATGGTAGTTTTTCCACTTTTATATCCAGAAATTTTTGAAAAATTTAAAATTCAGCCTCCAAGGGGCTGTTTGTTTTATGGTCCTCCTGGCACAGGTAAAACCTTGGTTGCTAGAGCTTTAGCTAATGAATGCAGTCAAGGAGACAAAAAGGTAGCATTTTTCATGCGAAAAGGAGCAGACTGTTTGAGCAAGTGGGTCGGGGAGTCAGAAAGGCAGCTGAGGCTGCTCTTTGATCAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

TGCGAAAAGGAGCAGACTGT

59.89

AGCCTCTCTACTTCGCCTGA

60.03

152

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

TGCGAAAAGGAGCAGACTGT

59.89

CTACTTCGCCTGATCGACGG

60.32

145

PCR template sequence:

AGGAGACAAAAAGGTAGCATTTTTCATGCGAAAAGGAGCAGACTGTTTGAGCAAGTGGGTCGGGGAGTCAGAAAGGCAGCTGAGGCTGCTCTTTGATCAGTACTGCTGAAGCTGTATTACAAGAAATGGATAATATTAATATCCGACGAAACCGTCGATCAGGCGAAGTAGAGAGGCTTCGAATGTGGACAGATACAGAA

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

4

Interacting miRNAs (#binding sites)

mmu-miR-135a-5p(1), mmu-miR-217-5p(1), mmu-miR-382-5p(1), mmu-miR-207(1)

siRNAs for circular RNA silencing
Junction sequence

GCTCTTTGATCAGTACTGCTGAAGCT

siRNA sets

NA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCATAD2B_907_ORF_1

0.8922

0.054344338

0.953717423

891

ORF sequence:

ATGGATAATATTAATATCCGACGAAACCGTCGATCAGGCGAAGTAGAGAGGCTTCGAATGTGGACAGATACAGAATTTGAAAATATGGATATGTATTCAAGGGTAAAAAGACGAAGAAAATCACTGAGAAGAAATAGTTATGGGATACAGAATCATCATGAGGTTTCCACTGAGGGCGAGGAAGAAGAATCTCAAGAGGAGGATGGAGACATAGAGGTTGAAGAGGCAGAAGGAGAAGAAAATGATAGACCATATAACTTGAGACAAAGAAAAACAGTGGATCGATACCAAGCACCGCCTATAGTACCGGCTCATCAAAAAAAGAGGGAAAATACACTATTTGATATTCACAGGTCTCCAGCAAGAAGAAGCCATATCAGGAGAAAGAAACATGCCATTCACAGTAGTGATACAACTTCTTCTGATGAGGAACGCTTTGAAAGAAGGAAATCGAAAAGCATGGCAAGAGCAAGAAACAGATGTTTGCCGATGAACTTCAGAGCAGAAGATTTAGCTAGCGGCATCCTCCGAGAACGGGTGAAAGTGGGTGCAAGTTTGGCTGATGTTGATCCCATGAACATTGATAAATCAGTGCGGTTTGATAGCATAGGTGGATTGAGCCATCATATTCACGCTTTGAAGGAGATGGTAGTTTTTCCACTTTTATATCCAGAAATTTTTGAAAAATTTAAAATTCAGCCTCCAAGGGGCTGTTTGTTTTATGGTCCTCCTGGCACAGGTAAAACCTTGGTTGCTAGAGCTTTAGCTAATGAATGCAGTCAAGGAGACAAAAAGGTAGCATTTTTCATGCGAAAAGGAGCAGACTGTTTGAGCAAGTGGGTCGGGGAGTCAGAAAGGCAGCTGAGGCTGCTCTTTGATCAGTACTGCTGA

Peptide sequence:

MDNINIRRNRRSGEVERLRMWTDTEFENMDMYSRVKRRRKSLRRNSYGIQNHHEVSTEGEEEESQEEDGDIEVEEAEGEENDRPYNLRQRKTVDRYQAPPIVPAHQKKRENTLFDIHRSPARRSHIRRKKHAIHSSDTTSSDEERFERRKSKSMARARNRCLPMNFRAEDLASGILRERVKVGASLADVDPMNIDKSVRFDSIGGLSHHIHALKEMVVFPLLYPEIFEKFKIQPPRGCLFYGPPGTGKTLVARALANECSQGDKKVAFFMRKGADCLSKWVGESERQLRLLFDQYC

IRESfinder result

IRESfinder score

0.52585703

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page