top of page

mmu_circAtad2b_1924

Basic information of circular RNA
PanCircBase ID:

mmu_circAtad2b_1924

mm39_Chr. Position ID:

chr12|5011217|5077180|+

Gene name:

Atad2b

Transcript:

ENSMUST00000045664.7

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

15

Exon/intron indexes:

13,14,15,16,17,18,19,20,21,22,23,24,25,26,27

Exon/intron offsets:

0,4623,8134,12750,21215,21718,21901,24476,29670,45388,49035,52585,56765,63364,65825

Genomic length:

65963

Exon/intron sizes in nt:

8,91,60,91,29,72,91,01,00,00,00,00,00,00,00,00,00,00,00,000

Flanking exon/introns:

chr12:5008231-5011217|chr12:5077180-5081492

Splice length:

1924

Other database IDs:

circAtlas: mmu-Atad2b_0082

Human Ortholog IDs:
Mature spliced Sequence:

GCATATTTGATGAGGCCTTCTATAATATTTTTTGATGAAATAGATGGCTTAGCTCCTGTTCGTTCTAGTAGACAAGATCAGATCCACAGCTCTATAGTGTCAACCCTCCTTGCCCTTATGGATGGATTAGATAATAGAGGTGAAATTGTTGTTATTGGTGCTACAAACAGACTTGACTCTATTGATCCTGCACTCAGGAGACCTGGTCGTTTTGACAGAGAATTTCTTTTCAACCTGCCTGATCAAAGGGCCAGAAAGCACATCTTGCAGATCCACACCAGGGACTGGAACCCAAAACTGTCTGATGCATTTTTAGGAGAATTGGCAGAAAAATGTGTTGGCTACTGTGGAGCTGACATCAAGGCCCTGTGTACAGAAGCCGCCCTGACTGCCCTGCGGAGGCGCTACCCTCAGATCTATGCCAGCAGCCACAAGCTGCAGCTGGATGTCACCTCAATAGTGCTCAGCGCCCACGACTTCTACCATGCCATGCAGAACATCGTGCCTGCTTCCCAACGTGCTGTGATGTCTTCAGGACAGGCGCTGTCCCCCATTATAAGGCCATTGCTAGAAAGAAGTTTCAACAACATCTTAGCAGTCCTGCAAAAAATATTTCCTCATGCAGAAACTAGCCAGAACTTTGTTGCTGGGAGTGATTTGAATTGTCCAAGCTTAGAAATTAGCAGTGATTATGAAGAGACCAGCATCCCTGAGGTAAAATCTTCTGGGAAGTGTTTTCTGGGAAAAAAGCTGTGTTCCAAAGATAGCCAAGGCAGTACCTTTGTACACTTAAACTTTAACATGGCCTTTGGACCAACCTCTTATAGGCCTCGATTGTTGCTATCTGGAGAACGAGGTTCAGGACAAACTTCGCACCTTGCTCCAGCACTTTTGCATACACTAGAAAGATTCTCTGTGCATCGGCTCGATCTCCCAGCACTTTACTCAGTCAGTGCCAAAACACCTGAAGAATCATGTGCACAGATATTTCGAGAAGCTCGAAGAACAGTACCGAGTATTGTTTACATGCCTCATATTGGTGACTGGTGGGATGCTGTCAGTGACACTGTGAGAGCAACTTTCTTGACATTGCTGCAGGATATACCGTCTTTTTCACCTATATTTTTATTGTCTACCTCTGAAACCATGTACAGTGAACTGCCTGAAGAGGTTAAATGTATCTTTAGAATACAGTATGAAGAGGTATTATATATTCAAAGACCTATTGAAGAAGATCGAAGAAAATTTTTCCAAGAACTTATTCTCCATCAGGCGTCAATGGCACCACCACGAAGGAAACATACTGCTCTTCGTGCTATGGAAGTGCTTCCGCTTGCACTACCATCACCTCCTCGTCAGTTATCAGAATCAGAAAAAAATCGGATGGAAGACCAGGAGGAAAATACGTTACGAGAGTTGCGGTTGTTCCTCAGGGACGTTACCAAGAGGCTGGCCACAGATAAACGCTTTAACATCTTCAGCAAACCGGTGGATATTGAAGAGGTTTCAGATTACCTTGAAGTAATCAAAGAACCAATGGATTTATCGACAGTAATAACTAAAATTGATAAACATAATTATCTAACGGCTAAAGATTTCCTGCAAGATATTGACCTCATCTGTAGCAATGCTTTAGAATACAACCCAGACAAGGACCCCGGAGATAAAATTATTAGGCACAGAGCTTGTACCCTGAAGGACACTGCACATGCCATCATTGCAGCTGAGCTGGATCCTGAGTTTAATAAGCTCTGTGAAGAAATAAAGGAAGCAAGAATAAAGAGAGGCCTATCAGTAACAGCAGAACAAATAACTCCTCATGGTGCTGGTGCCCGCAAGACAGAGACTAGAGTGGAAGAGGCGTTTCGACACAAACAGAGAAACCCAATGGATGCCTGGCACAACTCTGCAAATAAATGTGCAT

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

AGAGTGGAAGAGGCGTTTCG

60.04

AACGAACAGGAGCTAAGCCA

59.31

140

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

GCCCGCAAGACAGAGACTAG

60.18

AACGAACAGGAGCTAAGCCA

59.31

158

PCR template sequence:

GCTGGTGCCCGCAAGACAGAGACTAGAGTGGAAGAGGCGTTTCGACACAAACAGAGAAACCCAATGGATGCCTGGCACAACTCTGCAAATAAATGTGCATGCATATTTGATGAGGCCTTCTATAATATTTTTTGATGAAATAGATGGCTTAGCTCCTGTTCGTTCTAGTAGACAAGATCAGATCCACAGCTCTATAGTGT

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

27

Interacting miRNAs (#binding sites)

mmu-miR-93-5p(2), mmu-miR-106b-5p(2), mmu-miR-29b-3p(2), mmu-miR-802-5p(2), mmu-miR-20b-5p(1), mmu-miR-106a-5p(1), mmu-miR-20a-5p(1), mmu-miR-17-5p(1), mmu-let-7e-5p(1), mmu-miR-30e-5p(1), mmu-miR-29a-3p(1), mmu-miR-29c-3p(1), mmu-miR-30a-5p(1), mmu-miR-324-5p(1), mmu-miR-30d-5p(1), mmu-miR-431-5p(1), mmu-miR-351-5p(1), mmu-miR-199b-3p(1), mmu-miR-199a-3p(1), mmu-miR-666-5p(1), mmu-miR-384-3p(1), mmu-miR-29b-2-5p(1), mmu-miR-129-5p(1), mmu-miR-5101(1), mmu-miR-539-5p(1), mmu-miR-335-3p(1), mmu-miR-1904(1)

siRNAs for circular RNA silencing
Junction sequence

AATAAATGTGCATGCATATTTGATGA

siRNA sets

NA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCATAD2B_1924_ORF_1

0.7779

0.083483965

0.99998473

2028

ORF sequence:

ATGGTGCTGGTGCCCGCAAGACAGAGACTAGAGTGGAAGAGGCGTTTCGACACAAACAGAGAAACCCAATGGATGCCTGGCACAACTCTGCAAATAAATGTGCATGCATATTTGATGAGGCCTTCTATAATATTTTTTGATGAAATAGATGGCTTAGCTCCTGTTCGTTCTAGTAGACAAGATCAGATCCACAGCTCTATAGTGTCAACCCTCCTTGCCCTTATGGATGGATTAGATAATAGAGGTGAAATTGTTGTTATTGGTGCTACAAACAGACTTGACTCTATTGATCCTGCACTCAGGAGACCTGGTCGTTTTGACAGAGAATTTCTTTTCAACCTGCCTGATCAAAGGGCCAGAAAGCACATCTTGCAGATCCACACCAGGGACTGGAACCCAAAACTGTCTGATGCATTTTTAGGAGAATTGGCAGAAAAATGTGTTGGCTACTGTGGAGCTGACATCAAGGCCCTGTGTACAGAAGCCGCCCTGACTGCCCTGCGGAGGCGCTACCCTCAGATCTATGCCAGCAGCCACAAGCTGCAGCTGGATGTCACCTCAATAGTGCTCAGCGCCCACGACTTCTACCATGCCATGCAGAACATCGTGCCTGCTTCCCAACGTGCTGTGATGTCTTCAGGACAGGCGCTGTCCCCCATTATAAGGCCATTGCTAGAAAGAAGTTTCAACAACATCTTAGCAGTCCTGCAAAAAATATTTCCTCATGCAGAAACTAGCCAGAACTTTGTTGCTGGGAGTGATTTGAATTGTCCAAGCTTAGAAATTAGCAGTGATTATGAAGAGACCAGCATCCCTGAGGTAAAATCTTCTGGGAAGTGTTTTCTGGGAAAAAAGCTGTGTTCCAAAGATAGCCAAGGCAGTACCTTTGTACACTTAAACTTTAACATGGCCTTTGGACCAACCTCTTATAGGCCTCGATTGTTGCTATCTGGAGAACGAGGTTCAGGACAAACTTCGCACCTTGCTCCAGCACTTTTGCATACACTAGAAAGATTCTCTGTGCATCGGCTCGATCTCCCAGCACTTTACTCAGTCAGTGCCAAAACACCTGAAGAATCATGTGCACAGATATTTCGAGAAGCTCGAAGAACAGTACCGAGTATTGTTTACATGCCTCATATTGGTGACTGGTGGGATGCTGTCAGTGACACTGTGAGAGCAACTTTCTTGACATTGCTGCAGGATATACCGTCTTTTTCACCTATATTTTTATTGTCTACCTCTGAAACCATGTACAGTGAACTGCCTGAAGAGGTTAAATGTATCTTTAGAATACAGTATGAAGAGGTATTATATATTCAAAGACCTATTGAAGAAGATCGAAGAAAATTTTTCCAAGAACTTATTCTCCATCAGGCGTCAATGGCACCACCACGAAGGAAACATACTGCTCTTCGTGCTATGGAAGTGCTTCCGCTTGCACTACCATCACCTCCTCGTCAGTTATCAGAATCAGAAAAAAATCGGATGGAAGACCAGGAGGAAAATACGTTACGAGAGTTGCGGTTGTTCCTCAGGGACGTTACCAAGAGGCTGGCCACAGATAAACGCTTTAACATCTTCAGCAAACCGGTGGATATTGAAGAGGTTTCAGATTACCTTGAAGTAATCAAAGAACCAATGGATTTATCGACAGTAATAACTAAAATTGATAAACATAATTATCTAACGGCTAAAGATTTCCTGCAAGATATTGACCTCATCTGTAGCAATGCTTTAGAATACAACCCAGACAAGGACCCCGGAGATAAAATTATTAGGCACAGAGCTTGTACCCTGAAGGACACTGCACATGCCATCATTGCAGCTGAGCTGGATCCTGAGTTTAATAAGCTCTGTGAAGAAATAAAGGAAGCAAGAATAAAGAGAGGCCTATCAGTAACAGCAGAACAAATAACTCCTCATGGTGCTGGTGCCCGCAAGACAGAGACTAGAGTGGAAGAGGCGTTTCGACACAAACAGAGAAACCCAATGGATGCCTGGCACAACTCTGCAAATAAATGTGCA

Peptide sequence:

MVLVPARQRLEWKRRFDTNRETQWMPGTTLQINVHAYLMRPSIIFFDEIDGLAPVRSSRQDQIHSSIVSTLLALMDGLDNRGEIVVIGATNRLDSIDPALRRPGRFDREFLFNLPDQRARKHILQIHTRDWNPKLSDAFLGELAEKCVGYCGADIKALCTEAALTALRRRYPQIYASSHKLQLDVTSIVLSAHDFYHAMQNIVPASQRAVMSSGQALSPIIRPLLERSFNNILAVLQKIFPHAETSQNFVAGSDLNCPSLEISSDYEETSIPEVKSSGKCFLGKKLCSKDSQGSTFVHLNFNMAFGPTSYRPRLLLSGERGSGQTSHLAPALLHTLERFSVHRLDLPALYSVSAKTPEESCAQIFREARRTVPSIVYMPHIGDWWDAVSDTVRATFLTLLQDIPSFSPIFLLSTSETMYSELPEEVKCIFRIQYEEVLYIQRPIEEDRRKFFQELILHQASMAPPRRKHTALRAMEVLPLALPSPPRQLSESEKNRMEDQEENTLRELRLFLRDVTKRLATDKRFNIFSKPVDIEEVSDYLEVIKEPMDLSTVITKIDKHNYLTAKDFLQDIDLICSNALEYNPDKDPGDKIIRHRACTLKDTAHAIIAAELDPEFNKLCEEIKEARIKRGLSVTAEQITPHGAGARKTETRVEEAFRHKQRNPMDAWHNSANKCA

IRESfinder result

IRESfinder score

0.635528122

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page