top of page

mmu_circAtad2b_1559

Basic information of circular RNA
PanCircBase ID:

mmu_circAtad2b_1559

mm39_Chr. Position ID:

chr12|5063802|5084596|+

Gene name:

Atad2b

Transcript:

ENSMUST00000045664.7

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

7

Exon/intron indexes:

24,25,26,27,28,29,30

Exon/intron offsets:

0,4180,10779,13240,17690,20230,20665

Genomic length:

20794

Exon/intron sizes in nt:

19,71,60,12,31,38,68,40,00,000

Flanking exon/introns:

chr12:5060388-5063802|chr12:5084596-5094005

Splice length:

1559

Other database IDs:

circAtlas: hsa-ATAD2B_0130, CIRCpedia: HSA_CIRCpedia_40194

Human Ortholog IDs:
Mature spliced Sequence:

CTCTTCGTGCTATGGAAGTGCTTCCGCTTGCACTACCATCACCTCCTCGTCAGTTATCAGAATCAGAAAAAAATCGGATGGAAGACCAGGAGGAAAATACGTTACGAGAGTTGCGGTTGTTCCTCAGGGACGTTACCAAGAGGCTGGCCACAGATAAACGCTTTAACATCTTCAGCAAACCGGTGGATATTGAAGAGGTTTCAGATTACCTTGAAGTAATCAAAGAACCAATGGATTTATCGACAGTAATAACTAAAATTGATAAACATAATTATCTAACGGCTAAAGATTTCCTGCAAGATATTGACCTCATCTGTAGCAATGCTTTAGAATACAACCCAGACAAGGACCCCGGAGATAAAATTATTAGGCACAGAGCTTGTACCCTGAAGGACACTGCACATGCCATCATTGCAGCTGAGCTGGATCCTGAGTTTAATAAGCTCTGTGAAGAAATAAAGGAAGCAAGAATAAAGAGAGGCCTATCAGTAACAGCAGAACAAATAACTCCTCATGGTGCTGGTGCCCGCAAGACAGAGACTAGAGTGGAAGAGGCGTTTCGACACAAACAGAGAAACCCAATGGATGCCTGGCACAACTCTGCAAATAAATGTGCATTTCGAGTCCGGAGAAAATCAAGGCGGCGATCACAGTGGGGTAAAGGAATTATTAAGAAAAGGAAAGTCAATAATTTAAAGAAAGATGAGGAAGACACCAAGTTTACAGACTATGACCATACAGAGGACAGGAAGTTGCTGGAGAATGGAGAGTTTGAGGTAAGCACTGATTGCCATGAGGAAAATGGAGAAGAGACTGGAGACTTATCTATGACCAACGATGAATCTTCATGTGACATCATGGATATGGACCAGGGTCAGAGGCTGAATAGTGGAGCGGGCACCAAAGAGAACTTTGCATCAACAGAAGAGGAGAGTTCAAATGAATCTCTGCTCGTCCACAGTAGCAGTTCCCTCAACCCCGAGCAGACATCTAAGAAAGAGCCCTTCCTTAAAGGCACCTGTCTAAATGGTGAGGCTTCCACTGACAGCTCTGAAGGAATTCCTGTTCTGGAGTGTCAGAATGGCAGAGTTCTTGAAGTAGTTCCTCTGCCTGATGGTGGAGAAAAGTCTAGTTCTGAACAAAAGATTGCTCTGGAGGAACAACTAAAAGACAAACCAGAAACATGGAATGAAAATCGTGGAGATGCTGCTGAGAAGCTAGAAGTGCTGGAATGTAGCAGTAGTGAGAAGCCCGAGCCTGGCCCTGATGCAGAGGGGAAAGAGACAGAGCTGGATAGAGAAGGTGCTTCTAAAGTTAAAAAATATCGTAAATTATTGTTAGAGCAGGCAAAACCAACAAACCTCGAACTGGTTCCAGAAGAGCCATCCGAGCCTGCGCCGCCTTTGGTAGTTGATCACGAGAGACTGCAGAAATTGCTTGATTTGTTGGTAGATAAAAGCAACAACCTGACAGTCGATCAGCTTGAGAGATTATATTCCCTCCTTAGTCAGAGCATCTACCGCCATCGTAAAGATTATGACAAATCTCAGCTTGTGGAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

ACCTGACAGTCGATCAGCTTG

60.07

CGAGGAGGTGATGGTAGTGC

59.9

144

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

CAACCTGACAGTCGATCAGCT

60.07

CGAGGAGGTGATGGTAGTGC

59.9

146

PCR template sequence:

CAACAACCTGACAGTCGATCAGCTTGAGAGATTATATTCCCTCCTTAGTCAGAGCATCTACCGCCATCGTAAAGATTATGACAAATCTCAGCTTGTGGAGCTCTTCGTGCTATGGAAGTGCTTCCGCTTGCACTACCATCACCTCCTCGTCAGTTATCAGAATCAGAAAAAAATCGGATGGAAGACCAGGAGGAAAATAC

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

21

Interacting miRNAs (#binding sites)

mmu-miR-15a-5p(1), mmu-miR-103-3p(1), mmu-miR-221-3p(1), mmu-miR-322-5p(1), mmu-miR-15b-5p(1), mmu-miR-29b-3p(1), mmu-miR-298-5p(1), mmu-miR-222-3p(1), mmu-miR-136-5p(1), mmu-miR-431-5p(1), mmu-miR-351-5p(1), mmu-miR-29b-1-5p(1), mmu-miR-107-3p(1), mmu-miR-666-5p(1), mmu-miR-207(1), mmu-miR-5101(1), mmu-miR-335-3p(1), mmu-miR-484(1), mmu-miR-452-3p(1), mmu-miR-1904(1), mmu-miR-7a-1-3p(1)

siRNAs for circular RNA silencing
Junction sequence

TCAGCTTGTGGAGCTCTTCGTGCTAT

siRNA sets

ATAGCACGAAGAGCTCCAC, TAGCACGAAGAGCTCCACA, CACGAAGAGCTCCACAAGC

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCATAD2B_1559_ORF_1

0.9271

0.186146817

0.999950842

1767

ORF sequence:

ATGGAAGTGCTTCCGCTTGCACTACCATCACCTCCTCGTCAGTTATCAGAATCAGAAAAAAATCGGATGGAAGACCAGGAGGAAAATACGTTACGAGAGTTGCGGTTGTTCCTCAGGGACGTTACCAAGAGGCTGGCCACAGATAAACGCTTTAACATCTTCAGCAAACCGGTGGATATTGAAGAGGTTTCAGATTACCTTGAAGTAATCAAAGAACCAATGGATTTATCGACAGTAATAACTAAAATTGATAAACATAATTATCTAACGGCTAAAGATTTCCTGCAAGATATTGACCTCATCTGTAGCAATGCTTTAGAATACAACCCAGACAAGGACCCCGGAGATAAAATTATTAGGCACAGAGCTTGTACCCTGAAGGACACTGCACATGCCATCATTGCAGCTGAGCTGGATCCTGAGTTTAATAAGCTCTGTGAAGAAATAAAGGAAGCAAGAATAAAGAGAGGCCTATCAGTAACAGCAGAACAAATAACTCCTCATGGTGCTGGTGCCCGCAAGACAGAGACTAGAGTGGAAGAGGCGTTTCGACACAAACAGAGAAACCCAATGGATGCCTGGCACAACTCTGCAAATAAATGTGCATTTCGAGTCCGGAGAAAATCAAGGCGGCGATCACAGTGGGGTAAAGGAATTATTAAGAAAAGGAAAGTCAATAATTTAAAGAAAGATGAGGAAGACACCAAGTTTACAGACTATGACCATACAGAGGACAGGAAGTTGCTGGAGAATGGAGAGTTTGAGGTAAGCACTGATTGCCATGAGGAAAATGGAGAAGAGACTGGAGACTTATCTATGACCAACGATGAATCTTCATGTGACATCATGGATATGGACCAGGGTCAGAGGCTGAATAGTGGAGCGGGCACCAAAGAGAACTTTGCATCAACAGAAGAGGAGAGTTCAAATGAATCTCTGCTCGTCCACAGTAGCAGTTCCCTCAACCCCGAGCAGACATCTAAGAAAGAGCCCTTCCTTAAAGGCACCTGTCTAAATGGTGAGGCTTCCACTGACAGCTCTGAAGGAATTCCTGTTCTGGAGTGTCAGAATGGCAGAGTTCTTGAAGTAGTTCCTCTGCCTGATGGTGGAGAAAAGTCTAGTTCTGAACAAAAGATTGCTCTGGAGGAACAACTAAAAGACAAACCAGAAACATGGAATGAAAATCGTGGAGATGCTGCTGAGAAGCTAGAAGTGCTGGAATGTAGCAGTAGTGAGAAGCCCGAGCCTGGCCCTGATGCAGAGGGGAAAGAGACAGAGCTGGATAGAGAAGGTGCTTCTAAAGTTAAAAAATATCGTAAATTATTGTTAGAGCAGGCAAAACCAACAAACCTCGAACTGGTTCCAGAAGAGCCATCCGAGCCTGCGCCGCCTTTGGTAGTTGATCACGAGAGACTGCAGAAATTGCTTGATTTGTTGGTAGATAAAAGCAACAACCTGACAGTCGATCAGCTTGAGAGATTATATTCCCTCCTTAGTCAGAGCATCTACCGCCATCGTAAAGATTATGACAAATCTCAGCTTGTGGAGCTCTTCGTGCTATGGAAGTGCTTCCGCTTGCACTACCATCACCTCCTCGTCAGTTATCAGAATCAGAAAAAAATCGGATGGAAGACCAGGAGGAAAATACGTTACGAGAGTTGCGGTTGTTCCTCAGGGACGTTACCAAGAGGCTGGCCACAGATAAACGCTTTAACATCTTCAGCAAACCGGTGGATATTGAAGAGGTTTCAGATTACCTTGAAGTAA

Peptide sequence:

MEVLPLALPSPPRQLSESEKNRMEDQEENTLRELRLFLRDVTKRLATDKRFNIFSKPVDIEEVSDYLEVIKEPMDLSTVITKIDKHNYLTAKDFLQDIDLICSNALEYNPDKDPGDKIIRHRACTLKDTAHAIIAAELDPEFNKLCEEIKEARIKRGLSVTAEQITPHGAGARKTETRVEEAFRHKQRNPMDAWHNSANKCAFRVRRKSRRRSQWGKGIIKKRKVNNLKKDEEDTKFTDYDHTEDRKLLENGEFEVSTDCHEENGEETGDLSMTNDESSCDIMDMDQGQRLNSGAGTKENFASTEEESSNESLLVHSSSSLNPEQTSKKEPFLKGTCLNGEASTDSSEGIPVLECQNGRVLEVVPLPDGGEKSSSEQKIALEEQLKDKPETWNENRGDAAEKLEVLECSSSEKPEPGPDAEGKETELDREGASKVKKYRKLLLEQAKPTNLELVPEEPSEPAPPLVVDHERLQKLLDLLVDKSNNLTVDQLERLYSLLSQSIYRHRKDYDKSQLVELFVLWKCFRLHYHHLLVSYQNQKKIGWKTRRKIRYESCGCSSGTLPRGWPQINALTSSANRWILKRFQITLK

IRESfinder result

IRESfinder score

0.536212723

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page