top of page

mmu_circAtad2_939

Basic information of circular RNA
PanCircBase ID:

mmu_circAtad2_939

mm39_Chr. Position ID:

chr15|57967826|57972013|-

Gene name:

Atad2

Transcript:

ENSMUST00000038194.5

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

5

Exon/intron indexes:

20,19,18,17,16

Exon/intron offsets:

0,1046,2294,3650,3872

Genomic length:

4187

Exon/intron sizes in nt:

136,186,187,115,315

Flanking exon/introns:

chr15:57966790-57967826|chr15:57972013-57973343

Splice length:

939

Other database IDs:

circAtlas: mmu-Atad2_0013

Human Ortholog IDs:
Mature spliced Sequence:

GCTACTGTGGTGCGGATATTAAGTCAATCTGTGCTGAAGCTGCTTTGTGCGCCCTGCGTCGACGGTACCCGCAGATCTACACCACCAGCGAGAAGCTTCAGCTGGATCTCTCTTCAATTACCATCTCAGCTAAGGATTTTGAGGCAGCTCTGCAGAAAATAAGACCAGCTTCCCAGAGAGCTGTGACATCACCCGGACAGGCACTGTCTGCCATTGTGAAACCACTTCTGCAAAATACTGTTCATAGGATCTTAGACGCCCTACAGAAAGTATTTCCACATGTGGAAGTTGGAACAAACAAATCTTTAAATTCAGATGTTTCTTGCCCTTTTCTAGAAAGTGATTTGGCATACAGTGATGATGATACACCATCTGTGTATGAAAATGGACTTTCTCAAAAAGAAAATTTAAATTTTCTTCATTTAAATAGAAATGCCTGTTACCAGCCTATGTCTTTTCGACCAAGACTATTGATAGTGGGAGAACCAGGATTTGGACAGAGTTCTCACTTGGCACCAGCTGTCATCCATGCTTTGGAAAAATTTACTGTATATACATTAGACATTCCTGTTCTTTTTGGCATCAGTACAACATCTCCTGAAGAGGCATGTTCCCAAATGATTCGTGAAGCTAAGAGAACAGCACCCAGCATAGTCTATGTCCCACATATCCATTTGTGGTGGGAAATAGTTGGACCGACACTCAAAGCCACATTTACAACATTATTACAGACTATACCTTCATTTGCTCCAGTTTTATTACTTGCAACTTCTGAGAAACCATACTCAGCTTTGCCGGAAGAGGTACAAGAATTGTTTACCCATGATTATGGAGAAATTTTTAATGTACAGTTACCAGATAAAGAAGAACGAACCAAATTTTTTGAAGACTTAATTTTAAAACAAGCTTCAAAGCCTCCTGTGTCACAAAAGAAAGCAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

ACCAGATAAAGAAGAACGAACCA

57.78

CTGGTGGTGTAGATCTGCGG

60.18

174

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

ACCAGATAAAGAAGAACGAACCAA

58.38

CTGGTGGTGTAGATCTGCGG

60.18

174

PCR template sequence:

TTTAATGTACAGTTACCAGATAAAGAAGAACGAACCAAATTTTTTGAAGACTTAATTTTAAAACAAGCTTCAAAGCCTCCTGTGTCACAAAAGAAAGCAGGCTACTGTGGTGCGGATATTAAGTCAATCTGTGCTGAAGCTGCTTTGTGCGCCCTGCGTCGACGGTACCCGCAGATCTACACCACCAGCGAGAAGCTTCA

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

11

Interacting miRNAs (#binding sites)

mmu-miR-29b-2-5p(2), mmu-miR-140-5p(1), mmu-miR-1a-3p(1), mmu-miR-206-3p(1), mmu-miR-30e-5p(1), mmu-miR-320-3p(1), mmu-miR-138-5p(1), mmu-miR-194-5p(1), mmu-miR-190b-5p(1), mmu-miR-673-5p(1), mmu-miR-5101(1)

siRNAs for circular RNA silencing
Junction sequence

CAAAAGAAAGCAGGCTACTGTGGTGC

siRNA sets

NA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCATAD2_939_ORF_1

1.001

-0.063766936

0.998666636

1428

ORF sequence:

ATGTCTTTTCGACCAAGACTATTGATAGTGGGAGAACCAGGATTTGGACAGAGTTCTCACTTGGCACCAGCTGTCATCCATGCTTTGGAAAAATTTACTGTATATACATTAGACATTCCTGTTCTTTTTGGCATCAGTACAACATCTCCTGAAGAGGCATGTTCCCAAATGATTCGTGAAGCTAAGAGAACAGCACCCAGCATAGTCTATGTCCCACATATCCATTTGTGGTGGGAAATAGTTGGACCGACACTCAAAGCCACATTTACAACATTATTACAGACTATACCTTCATTTGCTCCAGTTTTATTACTTGCAACTTCTGAGAAACCATACTCAGCTTTGCCGGAAGAGGTACAAGAATTGTTTACCCATGATTATGGAGAAATTTTTAATGTACAGTTACCAGATAAAGAAGAACGAACCAAATTTTTTGAAGACTTAATTTTAAAACAAGCTTCAAAGCCTCCTGTGTCACAAAAGAAAGCAGGCTACTGTGGTGCGGATATTAAGTCAATCTGTGCTGAAGCTGCTTTGTGCGCCCTGCGTCGACGGTACCCGCAGATCTACACCACCAGCGAGAAGCTTCAGCTGGATCTCTCTTCAATTACCATCTCAGCTAAGGATTTTGAGGCAGCTCTGCAGAAAATAAGACCAGCTTCCCAGAGAGCTGTGACATCACCCGGACAGGCACTGTCTGCCATTGTGAAACCACTTCTGCAAAATACTGTTCATAGGATCTTAGACGCCCTACAGAAAGTATTTCCACATGTGGAAGTTGGAACAAACAAATCTTTAAATTCAGATGTTTCTTGCCCTTTTCTAGAAAGTGATTTGGCATACAGTGATGATGATACACCATCTGTGTATGAAAATGGACTTTCTCAAAAAGAAAATTTAAATTTTCTTCATTTAAATAGAAATGCCTGTTACCAGCCTATGTCTTTTCGACCAAGACTATTGATAGTGGGAGAACCAGGATTTGGACAGAGTTCTCACTTGGCACCAGCTGTCATCCATGCTTTGGAAAAATTTACTGTATATACATTAGACATTCCTGTTCTTTTTGGCATCAGTACAACATCTCCTGAAGAGGCATGTTCCCAAATGATTCGTGAAGCTAAGAGAACAGCACCCAGCATAGTCTATGTCCCACATATCCATTTGTGGTGGGAAATAGTTGGACCGACACTCAAAGCCACATTTACAACATTATTACAGACTATACCTTCATTTGCTCCAGTTTTATTACTTGCAACTTCTGAGAAACCATACTCAGCTTTGCCGGAAGAGGTACAAGAATTGTTTACCCATGATTATGGAGAAATTTTTAATGTACAGTTACCAGATAAAGAAGAACGAACCAAATTTTTTGAAGACTTAATTTTAAAACAAGCTTCAAAGCCTCCTGTGTCACAAAAGAAAGCA

Peptide sequence:

MSFRPRLLIVGEPGFGQSSHLAPAVIHALEKFTVYTLDIPVLFGISTTSPEEACSQMIREAKRTAPSIVYVPHIHLWWEIVGPTLKATFTTLLQTIPSFAPVLLLATSEKPYSALPEEVQELFTHDYGEIFNVQLPDKEERTKFFEDLILKQASKPPVSQKKAGYCGADIKSICAEAALCALRRRYPQIYTTSEKLQLDLSSITISAKDFEAALQKIRPASQRAVTSPGQALSAIVKPLLQNTVHRILDALQKVFPHVEVGTNKSLNSDVSCPFLESDLAYSDDDTPSVYENGLSQKENLNFLHLNRNACYQPMSFRPRLLIVGEPGFGQSSHLAPAVIHALEKFTVYTLDIPVLFGISTTSPEEACSQMIREAKRTAPSIVYVPHIHLWWEIVGPTLKATFTTLLQTIPSFAPVLLLATSEKPYSALPEEVQELFTHDYGEIFNVQLPDKEERTKFFEDLILKQASKPPVSQKKA

IRESfinder result

IRESfinder score

0.80744734

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page