top of page

mmu_circAsh1l_1031

Basic information of circular RNA
PanCircBase ID:

mmu_circAsh1l_1031

mm39_Chr. Position ID:

chr3|88950425|88965947|+

Gene name:

Ash1l

Transcript:

ENSMUST00000186583.7

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

7

Exon/intron indexes:

11,12,13,14,15,16,17

Exon/intron offsets:

0,378,8870,9624,9958,11244,15369

Genomic length:

15522

Exon/intron sizes in nt:

2,07,14,71,09,16,59,51,00,000

Flanking exon/introns:

chr3:88942788-88950425|chr3:88965947-88970957

Splice length:

1031

Other database IDs:

circAtlas: mmu-Ash1l_0076

circBase: hsa_circ_0014567, circAtlas: hsa-SCAF8_0001, CIRCpedia: HSA_CIRCpedia_351322

Human Ortholog IDs:
Mature spliced Sequence:

AATGATCTTTGCTGAGTGTTCCCCTAACACTTGCCCCTGTGGTGAGCAGTGCTGTAACCAGAGGATACAGAGGCATGAGTGGGTGCAGTGTCTGGAACGATTTCGAGCTGAGGAAAAAGGTTGGGGAATTAGAACCAAAGAACCCCTAAAAGCTGGCCAGTTCATCATTGAATACCTAGGGGAAGTTGTCAGCGAACAAGAATTCAGGAACAGGATGATTGAGCAATATCATAATCACAGTGACCACTACTGTTTAAACCTGGATAGCGGAATGGTGATTGACAGTTACCGCATGGGAAATGAGGCCAGATTCATCAACCACAGCTGTGACCCAAATTGTGAAATGCAGAAATGGTCTGTTAATGGAGTGTACCGTATTGGACTGTATGCACTTAAGGATATGCCAGCTGGGACAGAGCTTACCTATGATTACAACTTTCATTCCTTCAATGTAGAAAAACAGCAACTTTGTAAATGTGGTTTTGAGAAGTGTCGAGGAATCATTGGAGGCAAGAGTCAACGGATGAACGGACTCCCTAGCCATAAAGGTAGCCAGTCTTCAAGCACGCATAGAAAGTCTGCACGGGCGAAAGAGAAGCGGAAGTCCAAGCACAAGCTGAAGAAAAGGAAAGGCCATCCCTCTGAAGAGCCCAGTGAAAACATCAACACCCCAACAAGATTGACTCCACAGTTACAGATGAAGCCAATGTCCAACAGAGAGAGGAACTTCGTGCTAAAGCACCATGTGTTCTTGGTGCGAAACTGGGAAAAGATCCATCAGAAGCAGGAGGAGGTGAAGCACACCCGTGACATCCACTCAGCATCGCTGTACACCCGCTGGAACGGCCTCTGTCGGGACGACGGGAACATTAAGTCTGATGTCTTCATGACCCAGTTCTCTGCCCTGCAGACAGCTAGATCTGTTCGAACAAGACGCTTGGCAGCTGCAGAGGAAAACCTGGAAGTGGCTCGGGCAGCGCGCCTAGCACAGATCTTCAAAGAGATCTGTGATGGCATCATCTCCTACAGAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

GCTGCAGAGGAAAACCTGGA

60.25

TACAGCACTGCTCACCACAG

59.97

144

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

AGCTGCAGAGGAAAACCTGG

60.25

TACAGCACTGCTCACCACAG

59.97

145

PCR template sequence:

AGACGCTTGGCAGCTGCAGAGGAAAACCTGGAAGTGGCTCGGGCAGCGCGCCTAGCACAGATCTTCAAAGAGATCTGTGATGGCATCATCTCCTACAGAGAATGATCTTTGCTGAGTGTTCCCCTAACACTTGCCCCTGTGGTGAGCAGTGCTGTAACCAGAGGATACAGAGGCATGAGTGGGTGCAGTGTCTGGAACGA

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

13

Interacting miRNAs (#binding sites)

mmu-miR-137-3p(1), mmu-miR-9-5p(1), mmu-miR-20a-5p(1), mmu-miR-17-5p(1), mmu-miR-375-3p(1), mmu-miR-146a-5p(1), mmu-miR-143-3p(1), mmu-miR-199b-3p(1), mmu-miR-218-5p(1), mmu-miR-199a-3p(1), mmu-miR-382-5p(1), mmu-miR-467b-5p(1), mmu-miR-673-5p(1)

siRNAs for circular RNA silencing
Junction sequence

ATCTCCTACAGAGAATGATCTTTGCT

siRNA sets

NA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCASH1L_1031_ORF_1

0.7583

0.261195545

0.990581851

1035

ORF sequence:

ATGATCTTTGCTGAGTGTTCCCCTAACACTTGCCCCTGTGGTGAGCAGTGCTGTAACCAGAGGATACAGAGGCATGAGTGGGTGCAGTGTCTGGAACGATTTCGAGCTGAGGAAAAAGGTTGGGGAATTAGAACCAAAGAACCCCTAAAAGCTGGCCAGTTCATCATTGAATACCTAGGGGAAGTTGTCAGCGAACAAGAATTCAGGAACAGGATGATTGAGCAATATCATAATCACAGTGACCACTACTGTTTAAACCTGGATAGCGGAATGGTGATTGACAGTTACCGCATGGGAAATGAGGCCAGATTCATCAACCACAGCTGTGACCCAAATTGTGAAATGCAGAAATGGTCTGTTAATGGAGTGTACCGTATTGGACTGTATGCACTTAAGGATATGCCAGCTGGGACAGAGCTTACCTATGATTACAACTTTCATTCCTTCAATGTAGAAAAACAGCAACTTTGTAAATGTGGTTTTGAGAAGTGTCGAGGAATCATTGGAGGCAAGAGTCAACGGATGAACGGACTCCCTAGCCATAAAGGTAGCCAGTCTTCAAGCACGCATAGAAAGTCTGCACGGGCGAAAGAGAAGCGGAAGTCCAAGCACAAGCTGAAGAAAAGGAAAGGCCATCCCTCTGAAGAGCCCAGTGAAAACATCAACACCCCAACAAGATTGACTCCACAGTTACAGATGAAGCCAATGTCCAACAGAGAGAGGAACTTCGTGCTAAAGCACCATGTGTTCTTGGTGCGAAACTGGGAAAAGATCCATCAGAAGCAGGAGGAGGTGAAGCACACCCGTGACATCCACTCAGCATCGCTGTACACCCGCTGGAACGGCCTCTGTCGGGACGACGGGAACATTAAGTCTGATGTCTTCATGACCCAGTTCTCTGCCCTGCAGACAGCTAGATCTGTTCGAACAAGACGCTTGGCAGCTGCAGAGGAAAACCTGGAAGTGGCTCGGGCAGCGCGCCTAGCACAGATCTTCAAAGAGATCTGTGATGGCATCATCTCCTACAGAGAATGA

Peptide sequence:

MIFAECSPNTCPCGEQCCNQRIQRHEWVQCLERFRAEEKGWGIRTKEPLKAGQFIIEYLGEVVSEQEFRNRMIEQYHNHSDHYCLNLDSGMVIDSYRMGNEARFINHSCDPNCEMQKWSVNGVYRIGLYALKDMPAGTELTYDYNFHSFNVEKQQLCKCGFEKCRGIIGGKSQRMNGLPSHKGSQSSSTHRKSARAKEKRKSKHKLKKRKGHPSEEPSENINTPTRLTPQLQMKPMSNRERNFVLKHHVFLVRNWEKIHQKQEEVKHTRDIHSASLYTRWNGLCRDDGNIKSDVFMTQFSALQTARSVRTRRLAAAEENLEVARAARLAQIFKEICDGIISYRE

IRESfinder result

IRESfinder score

0.480034124

IRES/non IRES

non-IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page