top of page

mmu_circAsap1_308

Basic information of circular RNA
PanCircBase ID:

mmu_circAsap1_308

mm39_Chr. Position ID:

chr15|64007654|64024779|-

Gene name:

Asap1

Transcript:

ENSMUST00000177371.8

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

4

Exon/intron indexes:

13,12,11,10

Exon/intron offsets:

0,2148,13800,17024

Genomic length:

17125

Exon/intron sizes in nt:

49,88,70,101

Flanking exon/introns:

chr15:64002116-64007654|chr15:64024779-64030730

Splice length:

308

Other database IDs:

circAtlas: mmu-Asap1_0018

Human Ortholog IDs:
Mature spliced Sequence:

GACTCTCAGAGCCGGCAAGGTGGGTACAGCATGCATCAGCTCCAGGGCAACAAGGAGTACGGCAGTGAAAAGAAGGGCTTCCTGCTGAAGAAGAGTGATGGGATCCGGAAAGTGTGGCAGAGACGGAAGTGTGCGGTCAAGAACGGGATCCTGACCATCTCCCACGCAACTTCCAACAGGCAGCCTGCTAAGTTAAACCTCCTCACCTGCCAAGTGAAACCGAATGCTGAGGACAAGAAGTCTTTTGACCTGATATCACATAATCGAACATATCACTTTCAAGCAGAAGATGAGCAGGATTATATAGC

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

GCCAAGTGAAACCGAATGCT

59.4

CTTGTTGCCCTGGAGCTGAT

60.32

154

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

GCCAAGTGAAACCGAATGCT

59.4

AGCTGATGCATGCTGTACCC

60.47

141

PCR template sequence:

GCCAAGTGAAACCGAATGCTGAGGACAAGAAGTCTTTTGACCTGATATCACATAATCGAACATATCACTTTCAAGCAGAAGATGAGCAGGATTATATAGCGACTCTCAGAGCCGGCAAGGTGGGTACAGCATGCATCAGCTCCAGGGCAACAAGGAGTACGGCAGTGAAAAGAAGGGCTTCCTGCTGAAGAAGAGTGATG

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

3

Interacting miRNAs (#binding sites)

mmu-miR-705(1), mmu-miR-29b-2-5p(1), mmu-miR-190b-5p(1)

siRNAs for circular RNA silencing
Junction sequence

AGGATTATATAGCGACTCTCAGAGCC

siRNA sets

AGAGTCGCTATATAATCCT, GAGAGTCGCTATATAATCC

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCASAP1_308_ORF_1

0.8007

0.278639673

0.502971757

366

ORF sequence:

ATGCATCAGCTCCAGGGCAACAAGGAGTACGGCAGTGAAAAGAAGGGCTTCCTGCTGAAGAAGAGTGATGGGATCCGGAAAGTGTGGCAGAGACGGAAGTGTGCGGTCAAGAACGGGATCCTGACCATCTCCCACGCAACTTCCAACAGGCAGCCTGCTAAGTTAAACCTCCTCACCTGCCAAGTGAAACCGAATGCTGAGGACAAGAAGTCTTTTGACCTGATATCACATAATCGAACATATCACTTTCAAGCAGAAGATGAGCAGGATTATATAGCGACTCTCAGAGCCGGCAAGGTGGGTACAGCATGCATCAGCTCCAGGGCAACAAGGAGTACGGCAGTGAAAAGAAGGGCTTCCTGCTGA

Peptide sequence:

MHQLQGNKEYGSEKKGFLLKKSDGIRKVWQRRKCAVKNGILTISHATSNRQPAKLNLLTCQVKPNAEDKKSFDLISHNRTYHFQAEDEQDYIATLRAGKVGTACISSRATRSTAVKRRASC

IRESfinder result

IRESfinder score

0.348869748

IRES/non IRES

non-IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page