top of page

mmu_circArl1_194

Basic information of circular RNA
PanCircBase ID:

mmu_circArl1_194

mm39_Chr. Position ID:

chr10|88571759|88573064|+

Gene name:

Arl1

Transcript:

ENSMUST00000116234.9

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

2

Exon/intron indexes:

3,4

Exon/intron offsets:

0,1193

Genomic length:

1305

Exon/intron sizes in nt:

82,112

Flanking exon/introns:

chr10:88569542-88571759|chr10:88573064-88577768

Splice length:

194

Other database IDs:

CIRCpedia: MMU_CIRCpedia_211779, circAtlas: mmu-Arl1_0002

circAtlas: hsa-ARL1_0002, CIRCpedia: HSA_CIRCpedia_6287

Human Ortholog IDs:
Mature spliced Sequence:

CTATTGGATTTAATGTGGAGACGGTGACATACAAAAATCTCAAATTCCAAGTTTGGGACTTAGGAGGACAGACAAGTATCAGGCCATACTGGAGATGTTATTATTCAAACACAGATGCAGTCATCTATGTCGTTGACAGTTGTGACCGAGATCGAATTGGCATTTCCAAGTCTGAGTTAGTTGCCATGTTGGAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

TCGTTGACAGTTGTGACCGA

59.54

TGTCTGTCCTCCTAAGTCCCA

59.57

139

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

TGACCGAGATCGAATTGGCA

59.47

TGTCTGTCCTCCTAAGTCCCA

59.57

126

PCR template sequence:

TTATTATTCAAACACAGATGCAGTCATCTATGTCGTTGACAGTTGTGACCGAGATCGAATTGGCATTTCCAAGTCTGAGTTAGTTGCCATGTTGGAGCTATTGGATTTAATGTGGAGACGGTGACATACAAAAATCTCAAATTCCAAGTTTGGGACTTAGGAGGACAGACAAGTATCAGGCCATACTGGAGATG

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

1

Interacting miRNAs (#binding sites)

mmu-miR-217-5p(1)

siRNAs for circular RNA silencing
Junction sequence

TGCCATGTTGGAGCTATTGGATTTAA

siRNA sets

AAATCCAATAGCTCCAACA, AATCCAATAGCTCCAACAT, TAAATCCAATAGCTCCAAC

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.609130099

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page