top of page

mmu_circArid4a_1446

Basic information of circular RNA
PanCircBase ID:

mmu_circArid4a_1446

mm39_Chr. Position ID:

chr12|71121709|71133435|+

Gene name:

Arid4a

Transcript:

ENSMUST00000046305.12

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

3

Exon/intron indexes:

20,21,22

Exon/intron offsets:

0,1507,11519

Genomic length:

11726

Exon/intron sizes in nt:

1134,105,207

Flanking exon/introns:

chr12:71119505-71121709|chr12:71133435-71134234

Splice length:

1446

Other database IDs:

CIRCpedia: MMU_CIRCpedia_27713, circAtlas: mmu-Arid4a_0015

Human Ortholog IDs:
Mature spliced Sequence:

ACTCCTGTTCATCTGATAGTGAGGCAGACGACCAGCTGGAGAAGAGCTCAGGGGGTGAAGATCTTTCTCCTGATGTCAAAGAAGAATTGGAAAAAAATGAAAATGCACATGATGATAAACTAGATGAAGAAAACCCAAAGATTGTACATATATCAAAAGAAAACGACAGGACTCAGGCACAGCCCTCAGACACCCTGACGGTGGAGGCAGGGGACAGCGATCAAATTGTGCATATTTTTGGAGACAAAGTGGACCAAGTAGAAGAATTTAAGAAACAGGTGGAAAAGTCTCCCAAAGGGAAGGGAAGGCGCAGCAAGACAAAAGACCTTTCGTTAGAACTTATAAAGATTTCACCTTTCGGCCAGGAGGAAGCAGGCAGCGAAGCTCATGGGGACGTTCATAGCCTGGAGTTTTCTTCACTAGAATGTAAAAACTTTTCTTCTACTGAAGATGACATCGACCCATATGAGAAAGAAAAAAAGTTGAAACGAAAAATCCTGGGACAGCAATCCCCAGAAAAAAAATTGAGACTTGATAATGGCATGGAAATGACAACTGGAGTGTCCCAAGAGAGGTCTGACGATGGCGCGGGAGCCGAGGGCATGAAAGGCGCACACGTGGAACAGCACTTTGAAACAGAAGGTGAAGGGATGCCATCGCTGACAGCCGAGCCCGACCAGGGCCTTCAAGAACTGACTAGTGAGAAATCGGACAGTCCAGCCGAAGAAGAACCGGTGCACACGCCACTCAAAGAAGAGGAGGATGCGATGCCTCTGATCGGGCCTGAAACCTTGGTTTGCCATGAGGTAGACCTGGATGATTTAGATGAGAAGGATAAGACCAGTATTGAGGATGTGGTAGTAGAAGGCTCTGAGTCTAACTCTCTGGCTTCCGTACCACCTGCCTTACCTCCTGTAGCACAGCATAACTTTTCCGTAGCTTCCCCACTCACTCTCAGCCAAGACGAGTCCCGAAGTATAAAGAGTGAGAGTGACATTACAATTGAAGTTGATAGCATCGCCGAAGAATCACAAGAAGGCCTCTGTGAGAGGGAATCGGCGAACGGGTTTGAAGCCAGTGTTGCCTCTGGTGCCTGTAGTATAATTGCACACGAGCGAGAGAGCAGAGAGAAGGGTCAGAAAAGGCCAAGCGATGGAAATAGTGGATTAATTGCAAAAAAGCAAAAGCGAACCCCAAAGCGGACAAGTGCTGCAGCCAAAACTGAAAAGAACGGAGCAGGACAGAGCAGTGACAGCGAGGACCTCCCCGCCATGGACAGCTCCAGTAACTGCACCCCAGTGAAGCGCCTTACCCTGCCCAAGTCACAGAAGCTGCCACGGTCTCCTGCAAGAACCTCGCCTCACATCAAAGATGCAGAGAAGGAGAAGCACCGAGAGAAGCATCCGAACTCCTCCCCCAGGACATACAAGTGGAGCTTCCAGCTCA

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

GCAAGAACCTCGCCTCACAT

60.67

ATCTTCACCCCCTGAGCTCT

59.96

162

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

GCAAGAACCTCGCCTCACAT

60.67

AGATCTTCACCCCCTGAGCT

59.96

164

PCR template sequence:

GCAAGAACCTCGCCTCACATCAAAGATGCAGAGAAGGAGAAGCACCGAGAGAAGCATCCGAACTCCTCCCCCAGGACATACAAGTGGAGCTTCCAGCTCAACTCCTGTTCATCTGATAGTGAGGCAGACGACCAGCTGGAGAAGAGCTCAGGGGGTGAAGATCTTTCTCCTGATGTCAAAGAAGAATTGGAAAAAAATGA

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

19

Interacting miRNAs (#binding sites)

mmu-miR-207(2), mmu-miR-200a-3p(1), mmu-miR-141-3p(1), mmu-miR-93-5p(1), mmu-miR-17-5p(1), mmu-miR-429-3p(1), mmu-let-7e-5p(1), mmu-let-7b-5p(1), mmu-miR-223-3p(1), mmu-let-7c-5p(1), mmu-miR-211-5p(1), mmu-miR-204-5p(1), mmu-miR-106b-5p(1), mmu-miR-431-5p(1), mmu-miR-125a-5p(1), mmu-miR-335-3p(1), mmu-miR-1199-5p(1), mmu-miR-540-3p(1), mmu-miR-697(1)

siRNAs for circular RNA silencing
Junction sequence

AGCTTCCAGCTCAACTCCTGTTCATC

siRNA sets

ATGAACAGGAGTTGAGCTG, GATGAACAGGAGTTGAGCT

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCARID4A_1446_ORF_1

1.0928

0.321116798

0.99999969

2349

ORF sequence:

ATGGAAATGACAACTGGAGTGTCCCAAGAGAGGTCTGACGATGGCGCGGGAGCCGAGGGCATGAAAGGCGCACACGTGGAACAGCACTTTGAAACAGAAGGTGAAGGGATGCCATCGCTGACAGCCGAGCCCGACCAGGGCCTTCAAGAACTGACTAGTGAGAAATCGGACAGTCCAGCCGAAGAAGAACCGGTGCACACGCCACTCAAAGAAGAGGAGGATGCGATGCCTCTGATCGGGCCTGAAACCTTGGTTTGCCATGAGGTAGACCTGGATGATTTAGATGAGAAGGATAAGACCAGTATTGAGGATGTGGTAGTAGAAGGCTCTGAGTCTAACTCTCTGGCTTCCGTACCACCTGCCTTACCTCCTGTAGCACAGCATAACTTTTCCGTAGCTTCCCCACTCACTCTCAGCCAAGACGAGTCCCGAAGTATAAAGAGTGAGAGTGACATTACAATTGAAGTTGATAGCATCGCCGAAGAATCACAAGAAGGCCTCTGTGAGAGGGAATCGGCGAACGGGTTTGAAGCCAGTGTTGCCTCTGGTGCCTGTAGTATAATTGCACACGAGCGAGAGAGCAGAGAGAAGGGTCAGAAAAGGCCAAGCGATGGAAATAGTGGATTAATTGCAAAAAAGCAAAAGCGAACCCCAAAGCGGACAAGTGCTGCAGCCAAAACTGAAAAGAACGGAGCAGGACAGAGCAGTGACAGCGAGGACCTCCCCGCCATGGACAGCTCCAGTAACTGCACCCCAGTGAAGCGCCTTACCCTGCCCAAGTCACAGAAGCTGCCACGGTCTCCTGCAAGAACCTCGCCTCACATCAAAGATGCAGAGAAGGAGAAGCACCGAGAGAAGCATCCGAACTCCTCCCCCAGGACATACAAGTGGAGCTTCCAGCTCAACTCCTGTTCATCTGATAGTGAGGCAGACGACCAGCTGGAGAAGAGCTCAGGGGGTGAAGATCTTTCTCCTGATGTCAAAGAAGAATTGGAAAAAAATGAAAATGCACATGATGATAAACTAGATGAAGAAAACCCAAAGATTGTACATATATCAAAAGAAAACGACAGGACTCAGGCACAGCCCTCAGACACCCTGACGGTGGAGGCAGGGGACAGCGATCAAATTGTGCATATTTTTGGAGACAAAGTGGACCAAGTAGAAGAATTTAAGAAACAGGTGGAAAAGTCTCCCAAAGGGAAGGGAAGGCGCAGCAAGACAAAAGACCTTTCGTTAGAACTTATAAAGATTTCACCTTTCGGCCAGGAGGAAGCAGGCAGCGAAGCTCATGGGGACGTTCATAGCCTGGAGTTTTCTTCACTAGAATGTAAAAACTTTTCTTCTACTGAAGATGACATCGACCCATATGAGAAAGAAAAAAAGTTGAAACGAAAAATCCTGGGACAGCAATCCCCAGAAAAAAAATTGAGACTTGATAATGGCATGGAAATGACAACTGGAGTGTCCCAAGAGAGGTCTGACGATGGCGCGGGAGCCGAGGGCATGAAAGGCGCACACGTGGAACAGCACTTTGAAACAGAAGGTGAAGGGATGCCATCGCTGACAGCCGAGCCCGACCAGGGCCTTCAAGAACTGACTAGTGAGAAATCGGACAGTCCAGCCGAAGAAGAACCGGTGCACACGCCACTCAAAGAAGAGGAGGATGCGATGCCTCTGATCGGGCCTGAAACCTTGGTTTGCCATGAGGTAGACCTGGATGATTTAGATGAGAAGGATAAGACCAGTATTGAGGATGTGGTAGTAGAAGGCTCTGAGTCTAACTCTCTGGCTTCCGTACCACCTGCCTTACCTCCTGTAGCACAGCATAACTTTTCCGTAGCTTCCCCACTCACTCTCAGCCAAGACGAGTCCCGAAGTATAAAGAGTGAGAGTGACATTACAATTGAAGTTGATAGCATCGCCGAAGAATCACAAGAAGGCCTCTGTGAGAGGGAATCGGCGAACGGGTTTGAAGCCAGTGTTGCCTCTGGTGCCTGTAGTATAATTGCACACGAGCGAGAGAGCAGAGAGAAGGGTCAGAAAAGGCCAAGCGATGGAAATAGTGGATTAATTGCAAAAAAGCAAAAGCGAACCCCAAAGCGGACAAGTGCTGCAGCCAAAACTGAAAAGAACGGAGCAGGACAGAGCAGTGACAGCGAGGACCTCCCCGCCATGGACAGCTCCAGTAACTGCACCCCAGTGAAGCGCCTTACCCTGCCCAAGTCACAGAAGCTGCCACGGTCTCCTGCAAGAACCTCGCCTCACATCAAAGATGCAGAGAAGGAGAAGCACCGAGAGAAGCATCCGAACTCCTCCCCCAGGACATACAAGTGGAGCTTCCAGCTC

Peptide sequence:

MEMTTGVSQERSDDGAGAEGMKGAHVEQHFETEGEGMPSLTAEPDQGLQELTSEKSDSPAEEEPVHTPLKEEEDAMPLIGPETLVCHEVDLDDLDEKDKTSIEDVVVEGSESNSLASVPPALPPVAQHNFSVASPLTLSQDESRSIKSESDITIEVDSIAEESQEGLCERESANGFEASVASGACSIIAHERESREKGQKRPSDGNSGLIAKKQKRTPKRTSAAAKTEKNGAGQSSDSEDLPAMDSSSNCTPVKRLTLPKSQKLPRSPARTSPHIKDAEKEKHREKHPNSSPRTYKWSFQLNSCSSDSEADDQLEKSSGGEDLSPDVKEELEKNENAHDDKLDEENPKIVHISKENDRTQAQPSDTLTVEAGDSDQIVHIFGDKVDQVEEFKKQVEKSPKGKGRRSKTKDLSLELIKISPFGQEEAGSEAHGDVHSLEFSSLECKNFSSTEDDIDPYEKEKKLKRKILGQQSPEKKLRLDNGMEMTTGVSQERSDDGAGAEGMKGAHVEQHFETEGEGMPSLTAEPDQGLQELTSEKSDSPAEEEPVHTPLKEEEDAMPLIGPETLVCHEVDLDDLDEKDKTSIEDVVVEGSESNSLASVPPALPPVAQHNFSVASPLTLSQDESRSIKSESDITIEVDSIAEESQEGLCERESANGFEASVASGACSIIAHERESREKGQKRPSDGNSGLIAKKQKRTPKRTSAAAKTEKNGAGQSSDSEDLPAMDSSSNCTPVKRLTLPKSQKLPRSPARTSPHIKDAEKEKHREKHPNSSPRTYKWSFQL

IRESfinder result

IRESfinder score

0.373270424

IRES/non IRES

non-IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page