top of page

mmu_circArhgap26_953

Basic information of circular RNA
PanCircBase ID:

mmu_circArhgap26_953

mm39_Chr. Position ID:

chr18|39230682|39283171|+

Gene name:

Arhgap26

Transcript:

ENSMUST00000097593.9

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

10

Exon/intron indexes:

2,3,4,5,6,7,8,9,10,11

Exon/intron offsets:

0,1942,4539,12825,14160,22489,24144,29203,34426,52410

Genomic length:

52489

Exon/intron sizes in nt:

96,62,72,102,111,105,130,101,95,79

Flanking exon/introns:

chr18:39126682-39230682|chr18:39283171-39338336

Splice length:

953

Other database IDs:

circBase: mmu_circ_0007322, CIRCpedia: MMU_CIRCpedia_19044, circAtlas: mmu-Arhgap26_0003

circBase: hsa_circ_0128189, circAtlas: hsa-ARHGAP26_0004, CIRCpedia: HSA_CIRCpedia_164659

Human Ortholog IDs:
Mature spliced Sequence:

ATTTGTCTTCGGCAAAGCGGAAGTTTGCAGATTCCTTAAATGAATTTAAATTTCAGTGTATAGGAGATGCCGAAACAGATGATGAGATGTGTATAGCGAGATCTTTGCAAGAATTTGCTGCTGTTCTCAGGAATCTTGAAGACGAGCGGAGTCGAATGATCGAGAATGCCAGCGAGGTGCTCATCACACCCTTGGAGAAGTTTCGAAAGGAGCAGATTGGGGCCGCCAGGGAAGCCAAAAAGAAGTATGACAAAGAGACCGAGAAGTACTGCGGCACCTTAGAAAAACATTTGAATTTGTCTTCCAAAAAGAAGGAATCCCAGCTACAGGAGGCAGACAGCCAAGTGGACCTGGTTCGGCAACATTTCTACGAAGTATCCCTGGAGTATGTCTTTAAGGTGCAGGAAGTGCAAGAGAGAAAGATGTTTGAGTTTGTAGAGCCTCTGCTGGCCTTCCTGCAAGGACTCTTCACTTTCTATCACCATGGTTATGAGCTGGCCAAGGATTTTGGTGACTTTAAGACACAGTTGACCATCAGCATACAAAATACAAGAAACCGCTTTGAAGGAACCAGGTCTGAGGTGGAATCGCTGATGAAGAAGATGAAGGAAAACCCCCTGGAGCACAAGACCATCAGCCCGTACACCATGGAAGGGTACCTGTACGTGCAGGAGAAGCGTCACTTTGGAACTTCCTGGGTGAAGCACTACTGTACCTACCAACGGGATTCCAAACAAATCACCATGGTTCCATTCGACCAAAAGTCAGGAGGAAAGGGGGGAGAAGACGAGTCCGTTACCCTCAAATCCTGCACACGGCGAAAGACAGACTCCATCGAGAAGCGATTCTGCTTTGACGTGGAAGCAGTAGACAGGCCAGGGGTTATCACCATGCAGGCGTTGTCGGAAGAGGACCGTAGGCTCTGGATGGAAGCCATGGATGGCCGGGAACCT

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

TATCACCATGCAGGCGTTGT

60.04

TCATCTGTTTCGGCATCTCCT

59.17

152

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

GACAGGCCAGGGGTTATCAC

60.11

TCATCTGTTTCGGCATCTCCT

59.17

166

PCR template sequence:

TGACGTGGAAGCAGTAGACAGGCCAGGGGTTATCACCATGCAGGCGTTGTCGGAAGAGGACCGTAGGCTCTGGATGGAAGCCATGGATGGCCGGGAACCTATTTGTCTTCGGCAAAGCGGAAGTTTGCAGATTCCTTAAATGAATTTAAATTTCAGTGTATAGGAGATGCCGAAACAGATGATGAGATGTGTATAGCGAG

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

13

Interacting miRNAs (#binding sites)

mmu-miR-207(2), mmu-miR-7b-5p(1), mmu-miR-322-5p(1), mmu-miR-15b-5p(1), mmu-miR-18a-5p(1), mmu-miR-7a-5p(1), mmu-miR-29b-1-5p(1), mmu-miR-199b-3p(1), mmu-miR-199a-3p(1), mmu-miR-224-5p(1), mmu-miR-680(1), mmu-miR-29b-2-5p(1), mmu-miR-5101(1)

siRNAs for circular RNA silencing
Junction sequence

TGGCCGGGAACCTATTTGTCTTCGGC

siRNA sets

NA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCARHGAP26_953_ORF_1

0.9942

0.372844175

0.990277859

906

ORF sequence:

ATGTGTATAGCGAGATCTTTGCAAGAATTTGCTGCTGTTCTCAGGAATCTTGAAGACGAGCGGAGTCGAATGATCGAGAATGCCAGCGAGGTGCTCATCACACCCTTGGAGAAGTTTCGAAAGGAGCAGATTGGGGCCGCCAGGGAAGCCAAAAAGAAGTATGACAAAGAGACCGAGAAGTACTGCGGCACCTTAGAAAAACATTTGAATTTGTCTTCCAAAAAGAAGGAATCCCAGCTACAGGAGGCAGACAGCCAAGTGGACCTGGTTCGGCAACATTTCTACGAAGTATCCCTGGAGTATGTCTTTAAGGTGCAGGAAGTGCAAGAGAGAAAGATGTTTGAGTTTGTAGAGCCTCTGCTGGCCTTCCTGCAAGGACTCTTCACTTTCTATCACCATGGTTATGAGCTGGCCAAGGATTTTGGTGACTTTAAGACACAGTTGACCATCAGCATACAAAATACAAGAAACCGCTTTGAAGGAACCAGGTCTGAGGTGGAATCGCTGATGAAGAAGATGAAGGAAAACCCCCTGGAGCACAAGACCATCAGCCCGTACACCATGGAAGGGTACCTGTACGTGCAGGAGAAGCGTCACTTTGGAACTTCCTGGGTGAAGCACTACTGTACCTACCAACGGGATTCCAAACAAATCACCATGGTTCCATTCGACCAAAAGTCAGGAGGAAAGGGGGGAGAAGACGAGTCCGTTACCCTCAAATCCTGCACACGGCGAAAGACAGACTCCATCGAGAAGCGATTCTGCTTTGACGTGGAAGCAGTAGACAGGCCAGGGGTTATCACCATGCAGGCGTTGTCGGAAGAGGACCGTAGGCTCTGGATGGAAGCCATGGATGGCCGGGAACCTATTTGTCTTCGGCAAAGCGGAAGTTTGCAGATTCCTTAA

Peptide sequence:

MCIARSLQEFAAVLRNLEDERSRMIENASEVLITPLEKFRKEQIGAAREAKKKYDKETEKYCGTLEKHLNLSSKKKESQLQEADSQVDLVRQHFYEVSLEYVFKVQEVQERKMFEFVEPLLAFLQGLFTFYHHGYELAKDFGDFKTQLTISIQNTRNRFEGTRSEVESLMKKMKENPLEHKTISPYTMEGYLYVQEKRHFGTSWVKHYCTYQRDSKQITMVPFDQKSGGKGGEDESVTLKSCTRRKTDSIEKRFCFDVEAVDRPGVITMQALSEEDRRLWMEAMDGREPICLRQSGSLQIP

IRESfinder result

IRESfinder score

0.333873299

IRES/non IRES

non-IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page