top of page

mmu_circArhgap26_716

Basic information of circular RNA
PanCircBase ID:

mmu_circArhgap26_716

mm39_Chr. Position ID:

chr18|39235221|39265203|+

Gene name:

Arhgap26

Transcript:

ENSMUST00000097593.9

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

7

Exon/intron indexes:

4,5,6,7,8,9,10

Exon/intron offsets:

0,8286,9621,17950,19605,24664,29887

Genomic length:

29982

Exon/intron sizes in nt:

72,102,111,105,130,101,95

Flanking exon/introns:

chr18:39232686-39235221|chr18:39265203-39283092

Splice length:

716

Other database IDs:

CIRCpedia: MMU_CIRCpedia_19046, circAtlas: mmu-Arhgap26_0015

circBase: hsa_circ_0142186, circAtlas: hsa-ARHGAP26_0012, CIRCpedia: HSA_CIRCpedia_101926

Human Ortholog IDs:
Mature spliced Sequence:

ATCGAGAATGCCAGCGAGGTGCTCATCACACCCTTGGAGAAGTTTCGAAAGGAGCAGATTGGGGCCGCCAGGGAAGCCAAAAAGAAGTATGACAAAGAGACCGAGAAGTACTGCGGCACCTTAGAAAAACATTTGAATTTGTCTTCCAAAAAGAAGGAATCCCAGCTACAGGAGGCAGACAGCCAAGTGGACCTGGTTCGGCAACATTTCTACGAAGTATCCCTGGAGTATGTCTTTAAGGTGCAGGAAGTGCAAGAGAGAAAGATGTTTGAGTTTGTAGAGCCTCTGCTGGCCTTCCTGCAAGGACTCTTCACTTTCTATCACCATGGTTATGAGCTGGCCAAGGATTTTGGTGACTTTAAGACACAGTTGACCATCAGCATACAAAATACAAGAAACCGCTTTGAAGGAACCAGGTCTGAGGTGGAATCGCTGATGAAGAAGATGAAGGAAAACCCCCTGGAGCACAAGACCATCAGCCCGTACACCATGGAAGGGTACCTGTACGTGCAGGAGAAGCGTCACTTTGGAACTTCCTGGGTGAAGCACTACTGTACCTACCAACGGGATTCCAAACAAATCACCATGGTTCCATTCGACCAAAAGTCAGGAGGAAAGGGGGGAGAAGACGAGTCCGTTACCCTCAAATCCTGCACACGGCGAAAGACAGACTCCATCGAGAAGCGATTCTGCTTTGACGTGGAAGCAGTAGACAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

ACCCTCAAATCCTGCACACG

60.61

CCCCAATCTGCTCCTTTCGA

59.75

141

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

CGGCGAAAGACAGACTCCAT

60.11

CTTCTTTTTGGCTTCCCTGGC

60

146

PCR template sequence:

AGGGGGGAGAAGACGAGTCCGTTACCCTCAAATCCTGCACACGGCGAAAGACAGACTCCATCGAGAAGCGATTCTGCTTTGACGTGGAAGCAGTAGACAGATCGAGAATGCCAGCGAGGTGCTCATCACACCCTTGGAGAAGTTTCGAAAGGAGCAGATTGGGGCCGCCAGGGAAGCCAAAAAGAAGTATGACAAAGAGA

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

10

Interacting miRNAs (#binding sites)

mmu-miR-207(2), mmu-miR-7b-5p(1), mmu-miR-18a-5p(1), mmu-miR-7a-5p(1), mmu-miR-29b-1-5p(1), mmu-miR-199b-3p(1), mmu-miR-199a-3p(1), mmu-miR-224-5p(1), mmu-miR-29b-2-5p(1), mmu-miR-5101(1)

siRNAs for circular RNA silencing
Junction sequence

AAGCAGTAGACAGATCGAGAATGCCA

siRNA sets

TTCTCGATCTGTCTACTGC, ATTCTCGATCTGTCTACTG, TCTCGATCTGTCTACTGCT

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCARHGAP26_716_ORF_1

0.8301

0.230752782

0.796917873

576

ORF sequence:

ATGTTTGAGTTTGTAGAGCCTCTGCTGGCCTTCCTGCAAGGACTCTTCACTTTCTATCACCATGGTTATGAGCTGGCCAAGGATTTTGGTGACTTTAAGACACAGTTGACCATCAGCATACAAAATACAAGAAACCGCTTTGAAGGAACCAGGTCTGAGGTGGAATCGCTGATGAAGAAGATGAAGGAAAACCCCCTGGAGCACAAGACCATCAGCCCGTACACCATGGAAGGGTACCTGTACGTGCAGGAGAAGCGTCACTTTGGAACTTCCTGGGTGAAGCACTACTGTACCTACCAACGGGATTCCAAACAAATCACCATGGTTCCATTCGACCAAAAGTCAGGAGGAAAGGGGGGAGAAGACGAGTCCGTTACCCTCAAATCCTGCACACGGCGAAAGACAGACTCCATCGAGAAGCGATTCTGCTTTGACGTGGAAGCAGTAGACAGATCGAGAATGCCAGCGAGGTGCTCATCACACCCTTGGAGAAGTTTCGAAAGGAGCAGATTGGGGCCGCCAGGGAAGCCAAAAAGAAGTATGACAAAGAGACCGAGAAGTACTGCGGCACCTTAG

Peptide sequence:

MFEFVEPLLAFLQGLFTFYHHGYELAKDFGDFKTQLTISIQNTRNRFEGTRSEVESLMKKMKENPLEHKTISPYTMEGYLYVQEKRHFGTSWVKHYCTYQRDSKQITMVPFDQKSGGKGGEDESVTLKSCTRRKTDSIEKRFCFDVEAVDRSRMPARCSSHPWRSFERSRLGPPGKPKRSMTKRPRSTAAP

IRESfinder result

IRESfinder score

0.378702821

IRES/non IRES

non-IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page