top of page

mmu_circArhgap12_337

Basic information of circular RNA
PanCircBase ID:

mmu_circArhgap12_337

mm39_Chr. Position ID:

chr18|6069830|6073286|-

Gene name:

Arhgap12

Transcript:

ENSMUST00000181989.8

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

2

Exon/intron indexes:

3,2

Exon/intron offsets:

0,3380

Genomic length:

3456

Exon/intron sizes in nt:

261,76

Flanking exon/introns:

chr18:6065845-6069830|chr18:6073286-6135803

Splice length:

337

Other database IDs:

CIRCpedia: MMU_CIRCpedia_24946, circAtlas: mmu-Arhgap12_0025

Human Ortholog IDs:
Mature spliced Sequence:

CAAAAATGAAGATTTAAGTGGACTATGAGTATGGAGTGGATTAAACAGGACTAATATTTCATCTAGAAACTGTGAGGCAACCACACCCCCTAATCAAGGAAGGCCAGATTCTCCAGTCTATGCTAACCTACAGGAACTGAAAATATCACAGTCTGCTCTTCCTCCTCTTCCTGGGAGCCCAGCAATTCAAGTTAATGGGGAATGGGAGACTCACAAAGACAGTTCAGGCCGTTGTTACTACTATAACCGCACAACCCAGGAGCGAACCTGGAAACCACCTCGATGGGCTCGAGATGTGAGCACAAGCCGAGATTTTCAGAGCCCAGGAGAGCAAGAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

ATGTGAGCACAAGCCGAGAT

59.75

TGATTAGGGGGTGTGGTTGC

59.96

140

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

ACCTGGAAACCACCTCGATG

59.68

TGATTAGGGGGTGTGGTTGC

59.96

168

PCR template sequence:

CTACTATAACCGCACAACCCAGGAGCGAACCTGGAAACCACCTCGATGGGCTCGAGATGTGAGCACAAGCCGAGATTTTCAGAGCCCAGGAGAGCAAGAGCAAAAATGAAGATTTAAGTGGACTATGAGTATGGAGTGGATTAAACAGGACTAATATTTCATCTAGAAACTGTGAGGCAACCACACCCCCTAATCAAGGA

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

3

Interacting miRNAs (#binding sites)

mmu-miR-27b-3p(1), mmu-miR-27a-3p(1), mmu-miR-29b-2-5p(1)

siRNAs for circular RNA silencing
Junction sequence

AGGAGAGCAAGAGCAAAAATGAAGAT

siRNA sets

TTCATTTTTGCTCTTGCTC, TCTTCATTTTTGCTCTTGC, CTTCATTTTTGCTCTTGCT

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.622401897

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page