top of page

mmu_circAp3d1_744

Basic information of circular RNA
PanCircBase ID:

mmu_circAp3d1_744

mm39_Chr. Position ID:

chr10|80547945|80551013|-

Gene name:

Ap3d1

Transcript:

ENSMUST00000020420.9

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

7

Exon/intron indexes:

23,22,21,20,19,18,17

Exon/intron offsets:

0,484,653,1445,1861,2135,2996

Genomic length:

3068

Exon/intron sizes in nt:

96,72,166,74,188,76,72

Flanking exon/introns:

chr10:80546666-80547945|chr10:80551013-80551704

Splice length:

744

Other database IDs:

circBase: mmu_circ_0000186, CIRCpedia: MMU_CIRCpedia_30580, circAtlas: mmu-Ap3d1_0004

Human Ortholog IDs:
Mature spliced Sequence:

CGGCGAGAGGCCCGGAAGCAGGAACAAGCCAACAACCCCTTCTACATCAAGAGCTCCCCATCCCCGCAGAAGCGATACCAGGATGCACCAGGTGTGGAACACATTCCTGTGGTACAGATCGACCTCTCAGTGCCTCTGAAAGTTCCAGGTATGCCCATGTCAGACCAGTATGTGAAGCTGGAGGAGCAGCGGCGACACCGGCAGCGGCTGGAGAAGGACAAGAAAAGGAAGAAGAAGGAGAAGGGCAAGCGGCGCCACAGCTCTCTCCCCACGGAGAGCGATGAGGACATTGCCCCTGCCCAGCGTGTGGACATTATCACTGAGGAGATGCCAGAGAATGCTTTGCCTAGTGACGAGGATGACAAAGACCCCAATGACCCCTACAGGGCGCTGGACATTGACCTGGATAAACCCCTGGCTGACAGTGAGAAGCTGCCTGTCCAGAAACATAGAAATGCGGAGGCGGTGAAGTCCCCAGAGAAGGAGGGTGTGCTCGGGGTAGAGAAGAAGAGCAAGAAGCCCAAGAAGAAGGAGAAGAAGACCAAAGAGAGAGAGAGAGAGAAGAAGGACAAGAAGGGTGAGGACTTAGACTTCTGGCTGTCCACCACCCCACCACCTGCTGCTGCCCCCATTCCTGCCCCGTCCACGGAAGAACTTGCTGCAAGCACTATCACCTCCCCTAAGGATGAGTGTGAGGTTCTCAAAGGGGAAGAGGAGGACCACGTGGATCATGACCAAGAAAGG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

TGCAAGCACTATCACCTCCC

59.75

GGGATGGGGAGCTCTTGATG

59.89

149

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

TGCAAGCACTATCACCTCCC

59.75

GGTGCATCCTGGTATCGCTT

60.18

174

PCR template sequence:

CACGGAAGAACTTGCTGCAAGCACTATCACCTCCCCTAAGGATGAGTGTGAGGTTCTCAAAGGGGAAGAGGAGGACCACGTGGATCATGACCAAGAAAGGCGGCGAGAGGCCCGGAAGCAGGAACAAGCCAACAACCCCTTCTACATCAAGAGCTCCCCATCCCCGCAGAAGCGATACCAGGATGCACCAGGTGTGGAAC

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

5

Interacting miRNAs (#binding sites)

mmu-miR-207(3), mmu-miR-9-5p(1), mmu-miR-15a-5p(1), mmu-miR-326-3p(1), mmu-miR-1198-5p(1)

siRNAs for circular RNA silencing
Junction sequence

TGACCAAGAAAGGCGGCGAGAGGCCC

siRNA sets

NA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCAP3D1_744_ORF_1

1.1586

0.607711015

0.99987866

1338

ORF sequence:

ATGCCCATGTCAGACCAGTATGTGAAGCTGGAGGAGCAGCGGCGACACCGGCAGCGGCTGGAGAAGGACAAGAAAAGGAAGAAGAAGGAGAAGGGCAAGCGGCGCCACAGCTCTCTCCCCACGGAGAGCGATGAGGACATTGCCCCTGCCCAGCGTGTGGACATTATCACTGAGGAGATGCCAGAGAATGCTTTGCCTAGTGACGAGGATGACAAAGACCCCAATGACCCCTACAGGGCGCTGGACATTGACCTGGATAAACCCCTGGCTGACAGTGAGAAGCTGCCTGTCCAGAAACATAGAAATGCGGAGGCGGTGAAGTCCCCAGAGAAGGAGGGTGTGCTCGGGGTAGAGAAGAAGAGCAAGAAGCCCAAGAAGAAGGAGAAGAAGACCAAAGAGAGAGAGAGAGAGAAGAAGGACAAGAAGGGTGAGGACTTAGACTTCTGGCTGTCCACCACCCCACCACCTGCTGCTGCCCCCATTCCTGCCCCGTCCACGGAAGAACTTGCTGCAAGCACTATCACCTCCCCTAAGGATGAGTGTGAGGTTCTCAAAGGGGAAGAGGAGGACCACGTGGATCATGACCAAGAAAGGCGGCGAGAGGCCCGGAAGCAGGAACAAGCCAACAACCCCTTCTACATCAAGAGCTCCCCATCCCCGCAGAAGCGATACCAGGATGCACCAGGTGTGGAACACATTCCTGTGGTACAGATCGACCTCTCAGTGCCTCTGAAAGTTCCAGGTATGCCCATGTCAGACCAGTATGTGAAGCTGGAGGAGCAGCGGCGACACCGGCAGCGGCTGGAGAAGGACAAGAAAAGGAAGAAGAAGGAGAAGGGCAAGCGGCGCCACAGCTCTCTCCCCACGGAGAGCGATGAGGACATTGCCCCTGCCCAGCGTGTGGACATTATCACTGAGGAGATGCCAGAGAATGCTTTGCCTAGTGACGAGGATGACAAAGACCCCAATGACCCCTACAGGGCGCTGGACATTGACCTGGATAAACCCCTGGCTGACAGTGAGAAGCTGCCTGTCCAGAAACATAGAAATGCGGAGGCGGTGAAGTCCCCAGAGAAGGAGGGTGTGCTCGGGGTAGAGAAGAAGAGCAAGAAGCCCAAGAAGAAGGAGAAGAAGACCAAAGAGAGAGAGAGAGAGAAGAAGGACAAGAAGGGTGAGGACTTAGACTTCTGGCTGTCCACCACCCCACCACCTGCTGCTGCCCCCATTCCTGCCCCGTCCACGGAAGAACTTGCTGCAAGCACTATCACCTCCCCTAAGGATGAGTGTGAGGTTCTCAAAGGGGAAGAGGAGGACCACGTGGATCATGACCAAGAAAGG

Peptide sequence:

MPMSDQYVKLEEQRRHRQRLEKDKKRKKKEKGKRRHSSLPTESDEDIAPAQRVDIITEEMPENALPSDEDDKDPNDPYRALDIDLDKPLADSEKLPVQKHRNAEAVKSPEKEGVLGVEKKSKKPKKKEKKTKEREREKKDKKGEDLDFWLSTTPPPAAAPIPAPSTEELAASTITSPKDECEVLKGEEEDHVDHDQERRREARKQEQANNPFYIKSSPSPQKRYQDAPGVEHIPVVQIDLSVPLKVPGMPMSDQYVKLEEQRRHRQRLEKDKKRKKKEKGKRRHSSLPTESDEDIAPAQRVDIITEEMPENALPSDEDDKDPNDPYRALDIDLDKPLADSEKLPVQKHRNAEAVKSPEKEGVLGVEKKSKKPKKKEKKTKEREREKKDKKGEDLDFWLSTTPPPAAAPIPAPSTEELAASTITSPKDECEVLKGEEEDHVDHDQER

IRESfinder result

IRESfinder score

0.191211477

IRES/non IRES

non-IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page