top of page

mmu_circAp3d1_166

Basic information of circular RNA
PanCircBase ID:

mmu_circAp3d1_166

mm39_Chr. Position ID:

chr10|80548598|80548764|-

Gene name:

Ap3d1

Transcript:

ENSMUST00000020420.9

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

1

Exon/intron indexes:

21

Exon/intron offsets:

0

Genomic length:

166

Exon/intron sizes in nt:

166

Flanking exon/introns:

chr10:80548501-80548598|chr10:80548764-80549390

Splice length:

166

Other database IDs:

circAtlas: mmu-Ap3d1_0009

Human Ortholog IDs:
Mature spliced Sequence:

ACCCCTGGCTGACAGTGAGAAGCTGCCTGTCCAGAAACATAGAAATGCGGAGGCGGTGAAGTCCCCAGAGAAGGAGGGTGTGCTCGGGGTAGAGAAGAAGAGCAAGAAGCCCAAGAAGAAGGAGAAGAAGACCAAAGAGAGAGAGAGAGAGAAGAAGGACAAGAAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

TCGGGGTAGAGAAGAAGAGCA

59.99

TGTTTCTGGACAGGCAGCTT

59.82

122

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

TCGGGGTAGAGAAGAAGAGCA

59.99

CTTCTCTGGGGACTTCACCG

59.75

156

PCR template sequence:

TCGGGGTAGAGAAGAAGAGCAAGAAGCCCAAGAAGAAGGAGAAGAAGACCAAAGAGAGAGAGAGAGAGAAGAAGGACAAGAAGACCCCTGGCTGACAGTGAGAAGCTGCCTGTCCAGAAACATAGAAATGCGGAGGCGGTGAAGTCCCCAGAGAAGGAGGGTGTGC

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

3

Interacting miRNAs (#binding sites)

mmu-miR-9-5p(1), mmu-miR-326-3p(1), mmu-miR-207(1)

siRNAs for circular RNA silencing
Junction sequence

GAAGGACAAGAAGACCCCTGGCTGAC

siRNA sets

NA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.212183522

IRES/non IRES

non-IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page