top of page

mmu_circAp1g1_643

Basic information of circular RNA
PanCircBase ID:

mmu_circAp1g1_643

mm39_Chr. Position ID:

chr8|110580173|110582365|+

Gene name:

Ap1g1

Transcript:

ENSMUST00000093157.13

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

5

Exon/intron indexes:

18,19,20,21,22

Exon/intron offsets:

0,1124,1441,1804,2031

Genomic length:

2192

Exon/intron sizes in nt:

10,51,42,12,71,08,161

Flanking exon/introns:

chr8:110578459-110580173|chr8:110582365-110585430

Splice length:

643

Other database IDs:

CIRCpedia: MMU_CIRCpedia_38066, circAtlas: mmu-Ap1g1_0014

circBase: hsa_circ_0105900, circAtlas: hsa-AP1G1_0022, CIRCpedia: HSA_CIRCpedia_82086

Human Ortholog IDs:
Mature spliced Sequence:

CCGAATTAAGAAAGTGGTTTCCATCTATGGGAGCAGCATCGACGTAGAGCTCCAGCAGAGGGCAGTAGAGTACAACGCACTTTTTAAGAAGTATGACCACATGAGGTCTGCCCTACTTGAAAGAATGCCTGTCATGGAAAAAGTGACCACAAATGGCCCTTCGGAGATCGTGCAGACAAATGGAGAGACAGAACCAGCGCCCCTAGAGACTAAACCACCACCCTCAGGGCCACAACCCACAAGCCAGGCCAATGATCTATTGGATTTGTTGGGAGGAAATGACATAACACCTGTTATCCCAACTGCACCTACAAGCAAACCAGCATCAGCTGGTGGAGAACTTCTCGACTTGCTAGGAGACATCACCCTGACAGGTGCTCCAGCTGCTGCTCCTACCCCTGCCTCAGTGCCACAGATATCCCAGCCCCCCTTCTTGTTGGATGGGCTTTCCTCACAGCCTCTCTTCAATGACATCGCTCCAGGCATCCCCTCCATCACAGCGTACAGTAAGAACGGCTTGAAGATAGAGTTCACCTTTGAACGGTCAAACACCAACCCCAGCGTAACAGTGATAACGATACAGGCCTCTAACAGCACAGAGCTAGACATGACGGACTTTGTTTTCCAGGCTGCAGTACCAAAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

AAACACCAACCCCAGCGTAA

60.11

TGCGTTGTACTCTACTGCCC

59.75

176

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

AAACACCAACCCCAGCGTAA

60.11

CTCTACGTCGATGCTGCTCC

60.32

146

PCR template sequence:

GTCAAACACCAACCCCAGCGTAACAGTGATAACGATACAGGCCTCTAACAGCACAGAGCTAGACATGACGGACTTTGTTTTCCAGGCTGCAGTACCAAAGCCGAATTAAGAAAGTGGTTTCCATCTATGGGAGCAGCATCGACGTAGAGCTCCAGCAGAGGGCAGTAGAGTACAACGCACTTTTTAAGAAGTATGACCAC

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

8

Interacting miRNAs (#binding sites)

mmu-miR-9-5p(1), mmu-miR-93-5p(1), mmu-miR-20a-5p(1), mmu-miR-709(1), mmu-miR-136-5p(1), mmu-miR-29b-1-5p(1), mmu-miR-3065-5p(1), mmu-miR-7a-1-3p(1)

siRNAs for circular RNA silencing
Junction sequence

TGCAGTACCAAAGCCGAATTAAGAAA

siRNA sets

TTTCTTAATTCGGCTTTGG, TAATTCGGCTTTGGTACTG, TTCTTAATTCGGCTTTGGT

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCAP1G1_643_ORF_1

1.0663

0.184043215

0.809329138

552

ORF sequence:

ATGAGGTCTGCCCTACTTGAAAGAATGCCTGTCATGGAAAAAGTGACCACAAATGGCCCTTCGGAGATCGTGCAGACAAATGGAGAGACAGAACCAGCGCCCCTAGAGACTAAACCACCACCCTCAGGGCCACAACCCACAAGCCAGGCCAATGATCTATTGGATTTGTTGGGAGGAAATGACATAACACCTGTTATCCCAACTGCACCTACAAGCAAACCAGCATCAGCTGGTGGAGAACTTCTCGACTTGCTAGGAGACATCACCCTGACAGGTGCTCCAGCTGCTGCTCCTACCCCTGCCTCAGTGCCACAGATATCCCAGCCCCCCTTCTTGTTGGATGGGCTTTCCTCACAGCCTCTCTTCAATGACATCGCTCCAGGCATCCCCTCCATCACAGCGTACAGTAAGAACGGCTTGAAGATAGAGTTCACCTTTGAACGGTCAAACACCAACCCCAGCGTAACAGTGATAACGATACAGGCCTCTAACAGCACAGAGCTAGACATGACGGACTTTGTTTTCCAGGCTGCAGTACCAAAGCCGAATTAA

Peptide sequence:

MRSALLERMPVMEKVTTNGPSEIVQTNGETEPAPLETKPPPSGPQPTSQANDLLDLLGGNDITPVIPTAPTSKPASAGGELLDLLGDITLTGAPAAAPTPASVPQISQPPFLLDGLSSQPLFNDIAPGIPSITAYSKNGLKIEFTFERSNTNPSVTVITIQASNSTELDMTDFVFQAAVPKPN

IRESfinder result

IRESfinder score

0.433445084

IRES/non IRES

non-IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page