top of page

mmu_circAnln_1322

Basic information of circular RNA
PanCircBase ID:

mmu_circAnln_1322

mm39_Chr. Position ID:

chr9|22267347|22283559|-

Gene name:

Anln

Transcript:

ENSMUST00000040912.9

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

9

Exon/intron indexes:

15,14,13,12,11,10,9,8,7

Exon/intron offsets:

0,2068,2561,4358,4770,6634,7938,12334,16104

Genomic length:

16212

Exon/intron sizes in nt:

12,71,83,13,61,48,14,60,00,00,00,00,000

Flanking exon/introns:

chr9:22264674-22267347|chr9:22283559-22284436

Splice length:

1322

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GAACGTGAAAAAGAACTGGCATGTCTTCGTGGTCGACTTGACAAGGGCAATTTATGGAGTGCAGAAAAGAATGAAAAGTCAAGAAGCAAGCATCTAGAAACCAAACAGGAAGTTCACTGTCAGAACACTCCACTCAAGAAACATCAAACTGTCGCAAGCACCCCATTGACTTCTGTAACAGATAAGGTGGCTGAAAATGAACCAGCAGTGAAGCTTTCTAGCACAGAGCCTGCAGGTTCCACTGAAAGCGAAATGACAAAGTCCAGCCCTTTGAAAATCACGTTGTTTTTAGAAGAAGAAAAATCCTTAAAAGTAGCATCAGACCTGGAGGTTGAGCAGAACACTGAAGCAGTGCGTGAGGTTGAGATGAGTGTGGACGATGAGGACATCAATAGCTCCAGAGTCATTAACGACATCTTCAGTGACGTCCTAGAGGAAGGGGAGCTGGATGTGGAAAAGAGCCAAGAGGAGATGGACCAAGTGGGAGCAGAAAACAGTGAGGAGCAGGAAGATGCGCTCAATATCTCTTCAATGTCTTTACTTGCTCCGCTAGCTCAGACGGTCGGTGTGGTGAGCCTAGAGAATGTAATTTCTTCACCTCCGTCGGAATTGAGAGACTCTAACCTAAGCGCTGCAAGTCCTAAGCCCGGGAAATTCCAGAGAACCCGCGTCCCTCGCGCCGAATCTGCCGATAGCCTCGGTTCTGAGGACCGGGACCTTCTCTATAGCATTGATGCATATAGGTCTCAAAGATTCAAAGAAACAGAACGCCCTTCCATAAAGCAAGTGATTGTTCGAAAGGAAGATGTTACTTCAAAGTTGGGTGAAAAGAAAAACGTATTTTCTGGTCAAGTTAATATCAAACAAAAAATGCAGGAGCTCAATAATGACATAAATTTGCAGCAGACAGTGATCTATCAGGCCAGTCAGGCTCTCAACTGCTGTGTGGATGAAGAACACGGGAAAGGATCCTTGGAAGAAGCTGAAGCAGAAAGACTTCTTCTGATTGCAACTGAGAAAAGAGCACTTCTGATTGATGAGCTGAATAAGCTGAAGAGTGAAGGACCTCAGAGGAGAAACAAGACCAGTGTCATATCCCAGAGTGAATTTGCTCCATCTAAAGGGTCAGTCACTCTGTCAGAAATCTGCTTGCCTCTGAAGGCAGATTTTGTCTGCAGCACTGCGCAAAAAACAGATGCATCAAATTATTACTACTTAATTATGCTAAAAGCTGGGGCTGAGCAGATGGTCGCCACTCCATTAGCAAGTACTGCAAACTCTCTCAGTGGTGACGCTCTGACATTTCCTACTACATTTACTCT

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

CAGATGGTCGCCACTCCATT

60.11

TCTGCACTCCATAAATTGCCCT

60.03

145

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

ATGGTCGCCACTCCATTAGC

60.18

TCTGCACTCCATAAATTGCCCT

60.03

142

PCR template sequence:

TGCTAAAAGCTGGGGCTGAGCAGATGGTCGCCACTCCATTAGCAAGTACTGCAAACTCTCTCAGTGGTGACGCTCTGACATTTCCTACTACATTTACTCTGAACGTGAAAAAGAACTGGCATGTCTTCGTGGTCGACTTGACAAGGGCAATTTATGGAGTGCAGAAAAGAATGAAAAGTCAAGAAGCAAGCATCTAGAAA

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

10

Interacting miRNAs (#binding sites)

mmu-miR-1904(2), mmu-miR-9-5p(1), mmu-miR-122-5p(1), mmu-miR-342-5p(1), mmu-miR-27a-5p(1), mmu-miR-325-3p(1), mmu-miR-29b-2-5p(1), mmu-miR-129-5p(1), mmu-miR-5101(1), mmu-miR-335-3p(1)

siRNAs for circular RNA silencing
Junction sequence

CTACATTTACTCTGAACGTGAAAAAG

siRNA sets

TTTTCACGTTCAGAGTAAA,TTTCACGTTCAGAGTAAAT,TTTTTCACGTTCAGAGTAA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCANLN_1322_ORF_1

1.0769

0.196203854

0.997325736

1167

ORF sequence:

ATGACAAAGTCCAGCCCTTTGAAAATCACGTTGTTTTTAGAAGAAGAAAAATCCTTAAAAGTAGCATCAGACCTGGAGGTTGAGCAGAACACTGAAGCAGTGCGTGAGGTTGAGATGAGTGTGGACGATGAGGACATCAATAGCTCCAGAGTCATTAACGACATCTTCAGTGACGTCCTAGAGGAAGGGGAGCTGGATGTGGAAAAGAGCCAAGAGGAGATGGACCAAGTGGGAGCAGAAAACAGTGAGGAGCAGGAAGATGCGCTCAATATCTCTTCAATGTCTTTACTTGCTCCGCTAGCTCAGACGGTCGGTGTGGTGAGCCTAGAGAATGTAATTTCTTCACCTCCGTCGGAATTGAGAGACTCTAACCTAAGCGCTGCAAGTCCTAAGCCCGGGAAATTCCAGAGAACCCGCGTCCCTCGCGCCGAATCTGCCGATAGCCTCGGTTCTGAGGACCGGGACCTTCTCTATAGCATTGATGCATATAGGTCTCAAAGATTCAAAGAAACAGAACGCCCTTCCATAAAGCAAGTGATTGTTCGAAAGGAAGATGTTACTTCAAAGTTGGGTGAAAAGAAAAACGTATTTTCTGGTCAAGTTAATATCAAACAAAAAATGCAGGAGCTCAATAATGACATAAATTTGCAGCAGACAGTGATCTATCAGGCCAGTCAGGCTCTCAACTGCTGTGTGGATGAAGAACACGGGAAAGGATCCTTGGAAGAAGCTGAAGCAGAAAGACTTCTTCTGATTGCAACTGAGAAAAGAGCACTTCTGATTGATGAGCTGAATAAGCTGAAGAGTGAAGGACCTCAGAGGAGAAACAAGACCAGTGTCATATCCCAGAGTGAATTTGCTCCATCTAAAGGGTCAGTCACTCTGTCAGAAATCTGCTTGCCTCTGAAGGCAGATTTTGTCTGCAGCACTGCGCAAAAAACAGATGCATCAAATTATTACTACTTAATTATGCTAAAAGCTGGGGCTGAGCAGATGGTCGCCACTCCATTAGCAAGTACTGCAAACTCTCTCAGTGGTGACGCTCTGACATTTCCTACTACATTTACTCTGAACGTGAAAAAGAACTGGCATGTCTTCGTGGTCGACTTGACAAGGGCAATTTATGGAGTGCAGAAAAGAATGAAAAGTCAAGAAGCAAGCATCTAG

Peptide sequence:

MTKSSPLKITLFLEEEKSLKVASDLEVEQNTEAVREVEMSVDDEDINSSRVINDIFSDVLEEGELDVEKSQEEMDQVGAENSEEQEDALNISSMSLLAPLAQTVGVVSLENVISSPPSELRDSNLSAASPKPGKFQRTRVPRAESADSLGSEDRDLLYSIDAYRSQRFKETERPSIKQVIVRKEDVTSKLGEKKNVFSGQVNIKQKMQELNNDINLQQTVIYQASQALNCCVDEEHGKGSLEEAEAERLLLIATEKRALLIDELNKLKSEGPQRRNKTSVISQSEFAPSKGSVTLSEICLPLKADFVCSTAQKTDASNYYYLIMLKAGAEQMVATPLASTANSLSGDALTFPTTFTLNVKKNWHVFVVDLTRAIYGVQKRMKSQEASI

IRESfinder result

IRESfinder score

0.563016801

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page