top of page

mmu_circAnkrd12_4757

Basic information of circular RNA
PanCircBase ID:

mmu_circAnkrd12_4757

mm39_Chr. Position ID:

chr17|66286496|66294488|-

Gene name:

Ankrd12

Transcript:

ENSMUST00000038116.13

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

2

Exon/intron indexes:

10,9

Exon/intron offsets:

0,3334

Genomic length:

7992

Exon/intron sizes in nt:

99,4658

Flanking exon/introns:

chr17:66283159-66286496|chr17:66294488-66331070

Splice length:

4757

Other database IDs:

CIRCpedia: MMU_CIRCpedia_216021, circAtlas: mmu-Ankrd12_0004

circAtlas: hsa-ANKRD12_0005, CIRCpedia: HSA_CIRCpedia_132031

Human Ortholog IDs:
Mature spliced Sequence:

ATTCAGAAGAGGCTCAGTCTGTAAATCCTTCTAGTGTTGATGAAAATATTGACTCAGAGACAGAGAAAGACTCTTTCGTCTGTGGCAGTAAAATCCTCCCAAGCAAAGCCCCGCTGCCTTCTGCACTGGATGAGTATGAGTTCAAAGATGATGATGAAGAAGAGATAAGTAAGATGATTGACGACAGGCACATTCTTAGGAAAGAACAGCGGAGAGAGAATGAATCTGAAGCAGAAAGGAGTGGTCTGTTTGCAAAACAGGAGAAAACCTTCTATTCTAAGTCATTTAAAACAAAAAAACAGAAGCCGTCAAGGGTTCTGTGCTCCAGTACTGAAAGCTCTGATGAAGAGGGTCTTCAGAACAGAAAGATTTCTACTGCTTGTTCTGTTGCTGAATCATCACATCCTGATATGCAAGCCAAAAAAGAATATGAATACAAACAGAAAGGCAAAGTTAAAAGAAAATTAAAAAATCAGAATAAAAACAAAGAGAACCAAGAGCTGAAACAAGAAAAAGAGGGGAAAGAAAATAGCAGGATAGCAACCTTGACAGTTAATACTGCGCTGGATTGTTCAGAAAAATACAGAGAGGAGGGGAACTTCAGGAAATCTTTTAGCCCAAAGGATGATACTTCATTACACTTATTTCATATTTCCACTGGTAAATCTCCCAAACATTCCTGTGGATTAAGTGAAAAACAGACACCACTGAAGCAAGAACACACGAAAGCATGCATATCCCCAGGAAGTTCTGAAATGTCATTACAGCCTGATCTCACTCGGTATGATAATGCAGAACCTGAAAGTTCAAATGTCAAATCTTATAAGCACAAGGAAAAAAACAAACAGCAGAAAGATTTTCACATAGAGTTTGGTGAAAAATCAAATGCCAAAATTAAAGATGAAGATCATAATCCAGCATTTGAAAACTCAGACTGCACACTGAAGAAGATGGATAAAGAGGGTAAAACATTAAAAAAACATAAATTAAAACATAAAGAGAAGGATAAAGAAAAGCACAAAAAGGAAGTTGAAGGTGAAAAGGAAAAATATAAAAATAAAGACAATGCTAAAGAGCTACAGAGGAGCATCGAATTTGACAGAGAGTTTTGGAAAGAAAATTTTTTTAAAAGTGATGAAACTGAGGATCTCTTTTTAACTATGGAACATGAGTCCATAATAGAAAAAAAGACAAAAATGGAAAAAAACATGAAAGATGATAGGTCAGCTAAAGAAAAGCATGTCTCAAAAGAAAGGAACTTTAAAGAAGAACGGGAAAAGACTAAAAAGGAAAATGAAAAATCTCTTAGGGAAGAAAAGGTAAAAGATCCGAAAGAAGAAAAAGACAGTGTATCCACAGAGAAGGAGGCCGAGTGCTGTTCGGTGGGTGTCAGTGTGAGCCAGGAAGCTGCAGGGCTGCATTCATCAGAAAAGGAAATGGATGCTGAGAAGCAAGAAAGACACACAAAAGAGAGGGAAAAGTCTGATCGGCGCTTTCAGACTAAGGAGAAAGAGCTTGACAGGAACGAGAGGAAATTTTCTGAAAAAGAAAAGAAGATAAAACATGAACATAAGTCAGAAAGAGAGAAGCTGGATTTCAGTGACTGCACTGACAGAGTGAGAGAGAAGGACAAGCTGTACTCACACCAGACAGAAAGGTGCCACAAGGACAGCGAGAAGCTGAAAAACACTGTCAGAAAGACTGATGACAGAGAGAGGAACAGAGAAAAGGCGGATAGAAAGCACGACAGAGAGAAACCTGAACGAGAGAGGTACTTAGCAGAAAACAAAGAAAAGCACTTAGAGAAAAGAAAGCAATCTGACAGCAGTGAGTATTCCAAATCAGAGAAGGTCAGAACTAAAGACAGAGACAGGGAAGGAGAGAAGAAGGAGAAACTTAGAGATAAAGAAAGTGTAAATGTAACTAACTTGAAACATTTGCAGGAAGAGAGAAAGTCCAGTACAGGAGACAGCAGTGGTAAAACCCAGCATGAGAAAGCTCTGTCCCTTAAAGAAAGGGCAAGAGATGAGCCTTTGAAAACTCCAGATGGAAAAGAGAAAGATAAAAAGGATATAGACAGATACAAAGAGCGAGACAAGCGTAAAGATAAAGCCCAGCTAAATACTTTAATCAGACTAAAATCTGAAACAGAGAAGCTTAAACCTAAATTATCACCAGCATCAAAAGATACTCGACCTAAAGAAAAGAGGTTAGTAAATGATGATTTAATGCAGACAAGTTTTGAACGAATGCTTAGCCTTAAAGACCTAGAAATAGAACAGTGGCACAGAAAACATAAGGAAAAAATTAAGCAAAAGGAAAAAGAACGATTACGCAATCGTACTTGTTTAGAACTTAAAGTAAAAGATAAAGAAAAAACAAAACATGCACCCACAGAATCCAAAAGTAAAGAACTTACCAGGTCAAGAAGTTCAGAGTTGACTGATGTTTATAGCAAGGAGAAACAATCTAAAGATGTTGGCAGTAATCGCTCACAATCTGTTGACAACAGAAATGTATTGAATTTAGGAAAGCCATCCTACATTTCAGAGAGTGGCTCCAACCGGTCTCCTAGGTCGGAAGGTGAGAGGCTGGGTCTTAGCTCTAGGTCTGTGTCCATGCTTTCTGTTGCTAGTTCAGAAGACTCTTGCCATACAGTGACAACCCCAAGGCCTCTCGTTGAGTATGACTCTGACTTTATGTTAGAGGGCTCGGAATCTCAGTTGTCATTTTCTCAGTCACCTTTTTTGCCAAATGCCAAATCTCCAGCTCTTTATGAAAGAGAGCTGGAGGGTCTCACTGAACTACCAGACCGACTTAAACCACCATATACAAACAGACTTCCAGTGTGCCATCTCAGGTCATCTTCTGTGGAAGATGTTAAACTAATTACTAATGAGGTAAGACCTGCTGTAGAAATTAGAAGATGCAGTATGCCCTCAGTTATCTGTGAGCCCATAAAACATTTCCAAGTATCAGAAGAAAGCAGTCAAGGCAACTTAGCTGTTCCCAGAGAGACCTGTCTGTCTCCCAAGCCTGAAGTGTCTTCAGCAGTACCTGAGAGGGGCCTTTCGCATGTGTCTGACTTACATCCTAACTGTACAGGCTCTCCAACGAGGTCTGCAAACAGCAGCTATATTTCATCTGATGTAAATGTAATCAAGAGTGCAACTCTTGTGGGTACACTGATTGACAGTTCGATGCATTTGGAACCGTCTAATCAGGTTGGAGTGATTCCAAGTAAATCATGGGAGACGCCTGTTGATAAACTGGAGTCTTTAAGCACCAATGACTTCATCTGTCCAGATTCTAATATATCTGATCAAGATTCCTCTGCTCAGAGTTTTTATAATTCAGAAAACAAAATGTTAAGAGAACAAAATACTGACTGCTTACCTCCGCACCAGCCTGAACTGCCAGGAAACTCATGTGCTCAGGACCCAGCATCCTTTCTGTCTTCACCTCAGCCCTGCTCTTTTTCCAACCAACCACTGGCAGGTGCTGACTCTGTTCCGAAACCCGTGTCTTTGTCATATGTTGTCAGTCAAGAGCCAGGTGTTTTACAACAGAAAAGTGCAGCTCAGATGGCCAGTTCTGTTTTAGATAGTGATAATAACTTTCCAGAGGATGTGGAAAATACATTTGTCTTAGCAGACATTCAGAAGACAAATTCTTTTTTACCAGCTTACTCTGAAAGCACTGTGCAAGAAGCACTCCCAAGCTTTGAGAAGGCCAATACTTTGCTTGTGTTGCCATCAGAAAAGGACTTCAATGGGAGTGATACTGCTCAGCCAAACACACATTATGCATTTAGCAAACTCACATACAAGTCTTCCAATAGCCAGGAAATTGAGAAGGGCCCAGATGATACTCAAATCATTTCACATGAAAAGGAAAACAAATTACAAAGTTTGGTCTTAACTCAGTTGAGTAAATGTGATTCTGATTTGTATGAGATGAATGCAGGGCTGCCAAAAGGAAACCTGAATGAACAGGATAACCCAAAGCATGGTCTTGACAGCGAAAAGTACTCGCTTTCCACTGAAGATGAAGAATCTCAGCAGAGCACCTTATCAAGTGTGGAAAACCATTCACAGCAGTCGGCCCAACCAGAGATGCATAAATATGACCAGCTTAGTAAAGTAGAACTAGAAGAAAATGCCGAAGACGATAAAACTGAAAACCAGACCCCTCAAAGAGTGACTAGAAACAAAGCAAGCACAGTGGTCAATCCAAGCAAGCCCATGCTTGCTGGCTGTGCCCTTGTAGCAGAGAAAGATAACGAGTCCTCCCCTAGGGGACGAATCAGACTCACTGAAGAGGATGATCCTCAGATCCACCATCCTCGGAAGAGGAAAGTGTCACGGGTTCCTCAGCCTGTGCAAGTGAGCCCCTCTTTACTGCAAGCAAAGGAGAAAACTCAGCAGTCTCTAGCAGCCATTGTAGATTCTCTGAAGTTAGATGAGATTGAGCCATACAGTTCTGAGAGAGCAAATCCATATTTTGAATATTTGCACATAAGAAAAAAAATTGAAGAAAAACGCAAGTTGCTATGTAGCGTTATCCCTCAAGCTCCTCAGTATTATGATGAATACGTAACGTTTAATGGATCCTATCTCCTGGATGGAAACCCCTTAAGCAAGATTTGTATTCCTACAATCACACCACCACCTTCGCTGTCAGATCCACTTAAAGAGCTCTTTCGGCAACAGGAAGTAGTAAGGATGAAACTGCGTTTGCAACATAGTATTGAAAGG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

AGCTCTTTCGGCAACAGGAA

59.89

ACTGCCACAGACGAAAGAGT

59.25

151

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

CACCTTCGCTGTCAGATCCA

59.75

ACTGCCACAGACGAAAGAGT

59.25

178

PCR template sequence:

AATCACACCACCACCTTCGCTGTCAGATCCACTTAAAGAGCTCTTTCGGCAACAGGAAGTAGTAAGGATGAAACTGCGTTTGCAACATAGTATTGAAAGGATTCAGAAGAGGCTCAGTCTGTAAATCCTTCTAGTGTTGATGAAAATATTGACTCAGAGACAGAGAAAGACTCTTTCGTCTGTGGCAGTAAAATCCTCCC

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

34

Interacting miRNAs (#binding sites)

mmu-miR-203-3p(2), mmu-miR-138-5p(2), mmu-miR-335-3p(2), mmu-miR-7b-5p(1), mmu-miR-206-3p(1), mmu-miR-221-3p(1), mmu-miR-135a-5p(1), mmu-miR-31-5p(1), mmu-miR-19b-3p(1), mmu-miR-200c-3p(1), mmu-miR-19a-3p(1), mmu-miR-152-3p(1), mmu-miR-148b-3p(1), mmu-miR-148a-3p(1), mmu-miR-18a-5p(1), mmu-miR-298-5p(1), mmu-miR-216a-5p(1), mmu-miR-7a-5p(1), mmu-miR-222-3p(1), mmu-miR-326-3p(1), mmu-miR-136-5p(1), mmu-miR-29b-1-5p(1), mmu-miR-192-5p(1), mmu-miR-183-5p(1), mmu-miR-215-5p(1), mmu-miR-297a-5p(1), mmu-miR-383-5p(1), mmu-miR-98-5p(1), mmu-miR-690(1), mmu-miR-342-3p(1), mmu-miR-466a-5p(1), mmu-miR-1187(1), mmu-miR-3470b(1), mmu-miR-296-3p(1)

siRNAs for circular RNA silencing
Junction sequence

TAGTATTGAAAGGATTCAGAAGAGGC

siRNA sets

TTCTGAATCCTTTCAATAC, TCTGAATCCTTTCAATACT

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCANKRD12_4757_ORF_1

0.9303

0.089545584

1

4608

ORF sequence:

ATGATTGACGACAGGCACATTCTTAGGAAAGAACAGCGGAGAGAGAATGAATCTGAAGCAGAAAGGAGTGGTCTGTTTGCAAAACAGGAGAAAACCTTCTATTCTAAGTCATTTAAAACAAAAAAACAGAAGCCGTCAAGGGTTCTGTGCTCCAGTACTGAAAGCTCTGATGAAGAGGGTCTTCAGAACAGAAAGATTTCTACTGCTTGTTCTGTTGCTGAATCATCACATCCTGATATGCAAGCCAAAAAAGAATATGAATACAAACAGAAAGGCAAAGTTAAAAGAAAATTAAAAAATCAGAATAAAAACAAAGAGAACCAAGAGCTGAAACAAGAAAAAGAGGGGAAAGAAAATAGCAGGATAGCAACCTTGACAGTTAATACTGCGCTGGATTGTTCAGAAAAATACAGAGAGGAGGGGAACTTCAGGAAATCTTTTAGCCCAAAGGATGATACTTCATTACACTTATTTCATATTTCCACTGGTAAATCTCCCAAACATTCCTGTGGATTAAGTGAAAAACAGACACCACTGAAGCAAGAACACACGAAAGCATGCATATCCCCAGGAAGTTCTGAAATGTCATTACAGCCTGATCTCACTCGGTATGATAATGCAGAACCTGAAAGTTCAAATGTCAAATCTTATAAGCACAAGGAAAAAAACAAACAGCAGAAAGATTTTCACATAGAGTTTGGTGAAAAATCAAATGCCAAAATTAAAGATGAAGATCATAATCCAGCATTTGAAAACTCAGACTGCACACTGAAGAAGATGGATAAAGAGGGTAAAACATTAAAAAAACATAAATTAAAACATAAAGAGAAGGATAAAGAAAAGCACAAAAAGGAAGTTGAAGGTGAAAAGGAAAAATATAAAAATAAAGACAATGCTAAAGAGCTACAGAGGAGCATCGAATTTGACAGAGAGTTTTGGAAAGAAAATTTTTTTAAAAGTGATGAAACTGAGGATCTCTTTTTAACTATGGAACATGAGTCCATAATAGAAAAAAAGACAAAAATGGAAAAAAACATGAAAGATGATAGGTCAGCTAAAGAAAAGCATGTCTCAAAAGAAAGGAACTTTAAAGAAGAACGGGAAAAGACTAAAAAGGAAAATGAAAAATCTCTTAGGGAAGAAAAGGTAAAAGATCCGAAAGAAGAAAAAGACAGTGTATCCACAGAGAAGGAGGCCGAGTGCTGTTCGGTGGGTGTCAGTGTGAGCCAGGAAGCTGCAGGGCTGCATTCATCAGAAAAGGAAATGGATGCTGAGAAGCAAGAAAGACACACAAAAGAGAGGGAAAAGTCTGATCGGCGCTTTCAGACTAAGGAGAAAGAGCTTGACAGGAACGAGAGGAAATTTTCTGAAAAAGAAAAGAAGATAAAACATGAACATAAGTCAGAAAGAGAGAAGCTGGATTTCAGTGACTGCACTGACAGAGTGAGAGAGAAGGACAAGCTGTACTCACACCAGACAGAAAGGTGCCACAAGGACAGCGAGAAGCTGAAAAACACTGTCAGAAAGACTGATGACAGAGAGAGGAACAGAGAAAAGGCGGATAGAAAGCACGACAGAGAGAAACCTGAACGAGAGAGGTACTTAGCAGAAAACAAAGAAAAGCACTTAGAGAAAAGAAAGCAATCTGACAGCAGTGAGTATTCCAAATCAGAGAAGGTCAGAACTAAAGACAGAGACAGGGAAGGAGAGAAGAAGGAGAAACTTAGAGATAAAGAAAGTGTAAATGTAACTAACTTGAAACATTTGCAGGAAGAGAGAAAGTCCAGTACAGGAGACAGCAGTGGTAAAACCCAGCATGAGAAAGCTCTGTCCCTTAAAGAAAGGGCAAGAGATGAGCCTTTGAAAACTCCAGATGGAAAAGAGAAAGATAAAAAGGATATAGACAGATACAAAGAGCGAGACAAGCGTAAAGATAAAGCCCAGCTAAATACTTTAATCAGACTAAAATCTGAAACAGAGAAGCTTAAACCTAAATTATCACCAGCATCAAAAGATACTCGACCTAAAGAAAAGAGGTTAGTAAATGATGATTTAATGCAGACAAGTTTTGAACGAATGCTTAGCCTTAAAGACCTAGAAATAGAACAGTGGCACAGAAAACATAAGGAAAAAATTAAGCAAAAGGAAAAAGAACGATTACGCAATCGTACTTGTTTAGAACTTAAAGTAAAAGATAAAGAAAAAACAAAACATGCACCCACAGAATCCAAAAGTAAAGAACTTACCAGGTCAAGAAGTTCAGAGTTGACTGATGTTTATAGCAAGGAGAAACAATCTAAAGATGTTGGCAGTAATCGCTCACAATCTGTTGACAACAGAAATGTATTGAATTTAGGAAAGCCATCCTACATTTCAGAGAGTGGCTCCAACCGGTCTCCTAGGTCGGAAGGTGAGAGGCTGGGTCTTAGCTCTAGGTCTGTGTCCATGCTTTCTGTTGCTAGTTCAGAAGACTCTTGCCATACAGTGACAACCCCAAGGCCTCTCGTTGAGTATGACTCTGACTTTATGTTAGAGGGCTCGGAATCTCAGTTGTCATTTTCTCAGTCACCTTTTTTGCCAAATGCCAAATCTCCAGCTCTTTATGAAAGAGAGCTGGAGGGTCTCACTGAACTACCAGACCGACTTAAACCACCATATACAAACAGACTTCCAGTGTGCCATCTCAGGTCATCTTCTGTGGAAGATGTTAAACTAATTACTAATGAGGTAAGACCTGCTGTAGAAATTAGAAGATGCAGTATGCCCTCAGTTATCTGTGAGCCCATAAAACATTTCCAAGTATCAGAAGAAAGCAGTCAAGGCAACTTAGCTGTTCCCAGAGAGACCTGTCTGTCTCCCAAGCCTGAAGTGTCTTCAGCAGTACCTGAGAGGGGCCTTTCGCATGTGTCTGACTTACATCCTAACTGTACAGGCTCTCCAACGAGGTCTGCAAACAGCAGCTATATTTCATCTGATGTAAATGTAATCAAGAGTGCAACTCTTGTGGGTACACTGATTGACAGTTCGATGCATTTGGAACCGTCTAATCAGGTTGGAGTGATTCCAAGTAAATCATGGGAGACGCCTGTTGATAAACTGGAGTCTTTAAGCACCAATGACTTCATCTGTCCAGATTCTAATATATCTGATCAAGATTCCTCTGCTCAGAGTTTTTATAATTCAGAAAACAAAATGTTAAGAGAACAAAATACTGACTGCTTACCTCCGCACCAGCCTGAACTGCCAGGAAACTCATGTGCTCAGGACCCAGCATCCTTTCTGTCTTCACCTCAGCCCTGCTCTTTTTCCAACCAACCACTGGCAGGTGCTGACTCTGTTCCGAAACCCGTGTCTTTGTCATATGTTGTCAGTCAAGAGCCAGGTGTTTTACAACAGAAAAGTGCAGCTCAGATGGCCAGTTCTGTTTTAGATAGTGATAATAACTTTCCAGAGGATGTGGAAAATACATTTGTCTTAGCAGACATTCAGAAGACAAATTCTTTTTTACCAGCTTACTCTGAAAGCACTGTGCAAGAAGCACTCCCAAGCTTTGAGAAGGCCAATACTTTGCTTGTGTTGCCATCAGAAAAGGACTTCAATGGGAGTGATACTGCTCAGCCAAACACACATTATGCATTTAGCAAACTCACATACAAGTCTTCCAATAGCCAGGAAATTGAGAAGGGCCCAGATGATACTCAAATCATTTCACATGAAAAGGAAAACAAATTACAAAGTTTGGTCTTAACTCAGTTGAGTAAATGTGATTCTGATTTGTATGAGATGAATGCAGGGCTGCCAAAAGGAAACCTGAATGAACAGGATAACCCAAAGCATGGTCTTGACAGCGAAAAGTACTCGCTTTCCACTGAAGATGAAGAATCTCAGCAGAGCACCTTATCAAGTGTGGAAAACCATTCACAGCAGTCGGCCCAACCAGAGATGCATAAATATGACCAGCTTAGTAAAGTAGAACTAGAAGAAAATGCCGAAGACGATAAAACTGAAAACCAGACCCCTCAAAGAGTGACTAGAAACAAAGCAAGCACAGTGGTCAATCCAAGCAAGCCCATGCTTGCTGGCTGTGCCCTTGTAGCAGAGAAAGATAACGAGTCCTCCCCTAGGGGACGAATCAGACTCACTGAAGAGGATGATCCTCAGATCCACCATCCTCGGAAGAGGAAAGTGTCACGGGTTCCTCAGCCTGTGCAAGTGAGCCCCTCTTTACTGCAAGCAAAGGAGAAAACTCAGCAGTCTCTAGCAGCCATTGTAGATTCTCTGAAGTTAGATGAGATTGAGCCATACAGTTCTGAGAGAGCAAATCCATATTTTGAATATTTGCACATAAGAAAAAAAATTGAAGAAAAACGCAAGTTGCTATGTAGCGTTATCCCTCAAGCTCCTCAGTATTATGATGAATACGTAACGTTTAATGGATCCTATCTCCTGGATGGAAACCCCTTAAGCAAGATTTGTATTCCTACAATCACACCACCACCTTCGCTGTCAGATCCACTTAAAGAGCTCTTTCGGCAACAGGAAGTAGTAAGGATGAAACTGCGTTTGCAACATAGTATTGAAAGGATTCAGAAGAGGCTCAGTCTGTAA

Peptide sequence:

MIDDRHILRKEQRRENESEAERSGLFAKQEKTFYSKSFKTKKQKPSRVLCSSTESSDEEGLQNRKISTACSVAESSHPDMQAKKEYEYKQKGKVKRKLKNQNKNKENQELKQEKEGKENSRIATLTVNTALDCSEKYREEGNFRKSFSPKDDTSLHLFHISTGKSPKHSCGLSEKQTPLKQEHTKACISPGSSEMSLQPDLTRYDNAEPESSNVKSYKHKEKNKQQKDFHIEFGEKSNAKIKDEDHNPAFENSDCTLKKMDKEGKTLKKHKLKHKEKDKEKHKKEVEGEKEKYKNKDNAKELQRSIEFDREFWKENFFKSDETEDLFLTMEHESIIEKKTKMEKNMKDDRSAKEKHVSKERNFKEEREKTKKENEKSLREEKVKDPKEEKDSVSTEKEAECCSVGVSVSQEAAGLHSSEKEMDAEKQERHTKEREKSDRRFQTKEKELDRNERKFSEKEKKIKHEHKSEREKLDFSDCTDRVREKDKLYSHQTERCHKDSEKLKNTVRKTDDRERNREKADRKHDREKPERERYLAENKEKHLEKRKQSDSSEYSKSEKVRTKDRDREGEKKEKLRDKESVNVTNLKHLQEERKSSTGDSSGKTQHEKALSLKERARDEPLKTPDGKEKDKKDIDRYKERDKRKDKAQLNTLIRLKSETEKLKPKLSPASKDTRPKEKRLVNDDLMQTSFERMLSLKDLEIEQWHRKHKEKIKQKEKERLRNRTCLELKVKDKEKTKHAPTESKSKELTRSRSSELTDVYSKEKQSKDVGSNRSQSVDNRNVLNLGKPSYISESGSNRSPRSEGERLGLSSRSVSMLSVASSEDSCHTVTTPRPLVEYDSDFMLEGSESQLSFSQSPFLPNAKSPALYERELEGLTELPDRLKPPYTNRLPVCHLRSSSVEDVKLITNEVRPAVEIRRCSMPSVICEPIKHFQVSEESSQGNLAVPRETCLSPKPEVSSAVPERGLSHVSDLHPNCTGSPTRSANSSYISSDVNVIKSATLVGTLIDSSMHLEPSNQVGVIPSKSWETPVDKLESLSTNDFICPDSNISDQDSSAQSFYNSENKMLREQNTDCLPPHQPELPGNSCAQDPASFLSSPQPCSFSNQPLAGADSVPKPVSLSYVVSQEPGVLQQKSAAQMASSVLDSDNNFPEDVENTFVLADIQKTNSFLPAYSESTVQEALPSFEKANTLLVLPSEKDFNGSDTAQPNTHYAFSKLTYKSSNSQEIEKGPDDTQIISHEKENKLQSLVLTQLSKCDSDLYEMNAGLPKGNLNEQDNPKHGLDSEKYSLSTEDEESQQSTLSSVENHSQQSAQPEMHKYDQLSKVELEENAEDDKTENQTPQRVTRNKASTVVNPSKPMLAGCALVAEKDNESSPRGRIRLTEEDDPQIHHPRKRKVSRVPQPVQVSPSLLQAKEKTQQSLAAIVDSLKLDEIEPYSSERANPYFEYLHIRKKIEEKRKLLCSVIPQAPQYYDEYVTFNGSYLLDGNPLSKICIPTITPPPSLSDPLKELFRQQEVVRMKLRLQHSIERIQKRLSL

IRESfinder result

IRESfinder score

0.630992419

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page