top of page

mmu_circAnkmy2_815

Basic information of circular RNA
PanCircBase ID:

mmu_circAnkmy2_815

mm39_Chr. Position ID:

chr12|36215868|36237784|+

Gene name:

Ankmy2

Transcript:

ENSMUST00000041640.5

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

6

Exon/intron indexes:

2,3,4,5,6,7

Exon/intron offsets:

0,4579,10710,16478,20856,21780

Genomic length:

21916

Exon/intron sizes in nt:

65,139,99,161,215,136

Flanking exon/introns:

chr12:36207422-36215868|chr12:36237784-36243668

Splice length:

815

Other database IDs:

circAtlas: mmu-Ankmy2_0001

circAtlas: hsa-ANKMY2_0010, CIRCpedia: HSA_CIRCpedia_132404

Human Ortholog IDs:
Mature spliced Sequence:

GTACTGTCCAAGAAGCCGGAAGACTGTTGTCTAGTAAGAATGTTCATGTCAACTGCTTGGATGAGAATGGAATGACTCCTTTGATGCATGCAGCCTATAAAGGGAAACTCGAGATGTGCAAGCTCCTCCTGCGCCATGGAGCTGACGCCAGTTGCCATCAGCATGAGCACGGGTACACAGCCCTCATGTTTGCTGCGCTTTCCGGTAATAAAGACATCACTTGGGTCATGCTGGAAGCAGGCGCAGAGACCGATGTTGTGAACTCGGTGGGAAGAACTGCTGCCCAGATGGCAGCCTTTGTGGGTCAGCACGATTGCGTGGCTATCATCAACAATTTCTTCCCTCGAGAGAGACTGGATTATTACACTAAACCCCAGGGACTGGATAAAGAGCCAAAACTGCCTCCAAAGTTGGCAGGCCCGCTACACAAAATCATCACCACAACGAATCTCCACCCTGTCAAGATCGTGATGCTTGTGAGTGAGAACCCTCTGCTGGCAGACGCAGCTGCTCTCGGTAAATGCTACAGGGTGATGGATTTGATCTGTGAGAAATGCATGAAACAGAGAGACATGAATGAAGTGTTGGCTATGAAAATGCACTACATCAGCTGCATCTTTCAGAAATGCATTACCTTCCTCAAAGAAGGAGAGAATAAGCTGGACACCCTGATCAGAAGCTTGTTGAAAGGCCGAGCGTCTGATGGCTTCCCGGTGTATCAGGAAAAGATCATCAGAGAAAGCATCCGGAAGTTTCCATACTGTGAAGCCACACTCCTACAGCAGCTGGTGCGAAGCATCGCTCCAGTTGAAATT

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

GAAGCCACACTCCTACAGCA

59.68

GGCTGCATGCATCAAAGGAG

59.9

146

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

TGAAGCCACACTCCTACAGC

59.68

GGCTGCATGCATCAAAGGAG

59.9

147

PCR template sequence:

GTATCAGGAAAAGATCATCAGAGAAAGCATCCGGAAGTTTCCATACTGTGAAGCCACACTCCTACAGCAGCTGGTGCGAAGCATCGCTCCAGTTGAAATTGTACTGTCCAAGAAGCCGGAAGACTGTTGTCTAGTAAGAATGTTCATGTCAACTGCTTGGATGAGAATGGAATGACTCCTTTGATGCATGCAGCCTATAA

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

13

Interacting miRNAs (#binding sites)

mmu-miR-27b-3p(1), mmu-miR-27a-3p(1), mmu-miR-122-5p(1), mmu-miR-204-5p(1), mmu-miR-18a-5p(1), mmu-miR-132-3p(1), mmu-miR-10b-5p(1), mmu-miR-10a-5p(1), mmu-miR-212-3p(1), mmu-miR-29b-2-5p(1), mmu-miR-452-3p(1), mmu-miR-574-5p(1), mmu-miR-338-3p(1)

siRNAs for circular RNA silencing
Junction sequence

TCCAGTTGAAATTGTACTGTCCAAGA

siRNA sets

CTTGGACAGTACAATTTCA, TTGGACAGTACAATTTCAA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCANKMY2_815_ORF_1

1.0978

0.261185582

0.976759834

819

ORF sequence:

ATGACTCCTTTGATGCATGCAGCCTATAAAGGGAAACTCGAGATGTGCAAGCTCCTCCTGCGCCATGGAGCTGACGCCAGTTGCCATCAGCATGAGCACGGGTACACAGCCCTCATGTTTGCTGCGCTTTCCGGTAATAAAGACATCACTTGGGTCATGCTGGAAGCAGGCGCAGAGACCGATGTTGTGAACTCGGTGGGAAGAACTGCTGCCCAGATGGCAGCCTTTGTGGGTCAGCACGATTGCGTGGCTATCATCAACAATTTCTTCCCTCGAGAGAGACTGGATTATTACACTAAACCCCAGGGACTGGATAAAGAGCCAAAACTGCCTCCAAAGTTGGCAGGCCCGCTACACAAAATCATCACCACAACGAATCTCCACCCTGTCAAGATCGTGATGCTTGTGAGTGAGAACCCTCTGCTGGCAGACGCAGCTGCTCTCGGTAAATGCTACAGGGTGATGGATTTGATCTGTGAGAAATGCATGAAACAGAGAGACATGAATGAAGTGTTGGCTATGAAAATGCACTACATCAGCTGCATCTTTCAGAAATGCATTACCTTCCTCAAAGAAGGAGAGAATAAGCTGGACACCCTGATCAGAAGCTTGTTGAAAGGCCGAGCGTCTGATGGCTTCCCGGTGTATCAGGAAAAGATCATCAGAGAAAGCATCCGGAAGTTTCCATACTGTGAAGCCACACTCCTACAGCAGCTGGTGCGAAGCATCGCTCCAGTTGAAATTGTACTGTCCAAGAAGCCGGAAGACTGTTGTCTAGTAAGAATGTTCATGTCAACTGCTTGGATGAGAATGGAATGA

Peptide sequence:

MTPLMHAAYKGKLEMCKLLLRHGADASCHQHEHGYTALMFAALSGNKDITWVMLEAGAETDVVNSVGRTAAQMAAFVGQHDCVAIINNFFPRERLDYYTKPQGLDKEPKLPPKLAGPLHKIITTTNLHPVKIVMLVSENPLLADAAALGKCYRVMDLICEKCMKQRDMNEVLAMKMHYISCIFQKCITFLKEGENKLDTLIRSLLKGRASDGFPVYQEKIIRESIRKFPYCEATLLQQLVRSIAPVEIVLSKKPEDCCLVRMFMSTAWMRME

IRESfinder result

IRESfinder score

0.349280752

IRES/non IRES

non-IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page