top of page

mmu_circAnk3_768

Basic information of circular RNA
PanCircBase ID:

mmu_circAnk3_768

mm39_Chr. Position ID:

chr10|69756267|69794902|+

Gene name:

Ank3

Transcript:

ENSMUST00000182884.8

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

6

Exon/intron indexes:

24,25,26,27,28,29

Exon/intron offsets:

0,7257,11956,30514,35488,38480

Genomic length:

38635

Exon/intron sizes in nt:

54,12,41,03,10,72,25,100

Flanking exon/introns:

chr10:69740340-69756267|chr10:69794902-69809551

Splice length:

768

Other database IDs:

circAtlas: mmu-Ank3_0054

CIRCpedia: HSA_CIRCpedia_1908

Human Ortholog IDs:
Mature spliced Sequence:

GTGATAAATGCACATGGTTCAAAATTCCCAAAGTACAGGAGGTTTTGGTGAAAAGTGAAGATGCCATCACAGGGGACACTGACAAGTATCTCGGGCCACAGGACCTTAAGGAGCTAGGTGATGACTCCCTGCCAGCAGAAGGTTACGTAGGCTTCAGTCTTGGAGCCCGTTCTGCCAGCCTCCGCTCCTTCAGTTCGGATAGGTCCTACACCTTGAACAGAAGCTCCTACGCAAGGGACAGCATGATGATAGAGGAACTTCTGGTACCATCCAAAGAGCAGCACCTGACGTTCACGAGGGAGTTTGATTCTGACTCCCTCAGACACTACAGTTGGGCAGCGGACACGTTAGATAATGTGAACCTGGTCTCAAGCCCGGTGCATTCTGGGTTTCTGGTTAGCTTTATGGTGGACGCGAGAGGGGGCTCCATGCGAGGAAGCCGCCACCACGGGATGCGGATCATCATCCCTCCGCGAAAGTGTACGGCCCCCACCCGCATCACGTGCCGCCTGGTAAAGAGACATAAACTGGCCAACCCACCCCCCATGGTGGAAGGAGAGGGATTAGCCAGTAGGCTGGTAGAAATGGGTCCTGCGGGGGCACAATTTTTAGGCCCCGTCATTGTGGAAATCCCTCATTTTGGGTCCATGAGGGGGAAGGAGAGAGAACTTATCGTCCTTCGGAGCGAGAACGGAGAGACCTGGAAGGAACATCAGTTTGACAGTAAAAACGAAGACCTCGCGGAGCTTCTCAATGGCATGGATGAAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

TATCGTCCTTCGGAGCGAGA

60.18

CCCCTGTGATGGCATCTTCA

59.74

173

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

TATCGTCCTTCGGAGCGAGA

60.18

GTCCCCTGTGATGGCATCTT

59.74

175

PCR template sequence:

CTTATCGTCCTTCGGAGCGAGAACGGAGAGACCTGGAAGGAACATCAGTTTGACAGTAAAAACGAAGACCTCGCGGAGCTTCTCAATGGCATGGATGAAGGTGATAAATGCACATGGTTCAAAATTCCCAAAGTACAGGAGGTTTTGGTGAAAAGTGAAGATGCCATCACAGGGGACACTGACAAGTATCTCGGGCCACA

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

4

Interacting miRNAs (#binding sites)

mmu-miR-324-5p(1), mmu-miR-434-3p(1), mmu-miR-501-3p(1), mmu-miR-541-5p(1)

siRNAs for circular RNA silencing
Junction sequence

GGCATGGATGAAGGTGATAAATGCAC

siRNA sets

TATCACCTTCATCCATGCC, TTATCACCTTCATCCATGC

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCANK3_768_ORF_1

1.0706

0.280845506

0.99924715

1293

ORF sequence:

ATGATGATAGAGGAACTTCTGGTACCATCCAAAGAGCAGCACCTGACGTTCACGAGGGAGTTTGATTCTGACTCCCTCAGACACTACAGTTGGGCAGCGGACACGTTAGATAATGTGAACCTGGTCTCAAGCCCGGTGCATTCTGGGTTTCTGGTTAGCTTTATGGTGGACGCGAGAGGGGGCTCCATGCGAGGAAGCCGCCACCACGGGATGCGGATCATCATCCCTCCGCGAAAGTGTACGGCCCCCACCCGCATCACGTGCCGCCTGGTAAAGAGACATAAACTGGCCAACCCACCCCCCATGGTGGAAGGAGAGGGATTAGCCAGTAGGCTGGTAGAAATGGGTCCTGCGGGGGCACAATTTTTAGGCCCCGTCATTGTGGAAATCCCTCATTTTGGGTCCATGAGGGGGAAGGAGAGAGAACTTATCGTCCTTCGGAGCGAGAACGGAGAGACCTGGAAGGAACATCAGTTTGACAGTAAAAACGAAGACCTCGCGGAGCTTCTCAATGGCATGGATGAAGGTGATAAATGCACATGGTTCAAAATTCCCAAAGTACAGGAGGTTTTGGTGAAAAGTGAAGATGCCATCACAGGGGACACTGACAAGTATCTCGGGCCACAGGACCTTAAGGAGCTAGGTGATGACTCCCTGCCAGCAGAAGGTTACGTAGGCTTCAGTCTTGGAGCCCGTTCTGCCAGCCTCCGCTCCTTCAGTTCGGATAGGTCCTACACCTTGAACAGAAGCTCCTACGCAAGGGACAGCATGATGATAGAGGAACTTCTGGTACCATCCAAAGAGCAGCACCTGACGTTCACGAGGGAGTTTGATTCTGACTCCCTCAGACACTACAGTTGGGCAGCGGACACGTTAGATAATGTGAACCTGGTCTCAAGCCCGGTGCATTCTGGGTTTCTGGTTAGCTTTATGGTGGACGCGAGAGGGGGCTCCATGCGAGGAAGCCGCCACCACGGGATGCGGATCATCATCCCTCCGCGAAAGTGTACGGCCCCCACCCGCATCACGTGCCGCCTGGTAAAGAGACATAAACTGGCCAACCCACCCCCCATGGTGGAAGGAGAGGGATTAGCCAGTAGGCTGGTAGAAATGGGTCCTGCGGGGGCACAATTTTTAGGCCCCGTCATTGTGGAAATCCCTCATTTTGGGTCCATGAGGGGGAAGGAGAGAGAACTTATCGTCCTTCGGAGCGAGAACGGAGAGACCTGGAAGGAACATCAGTTTGACAGTAAAAACGAAGACCTCGCGGAGCTTCTCAATGGCATGGATGAA

Peptide sequence:

MMIEELLVPSKEQHLTFTREFDSDSLRHYSWAADTLDNVNLVSSPVHSGFLVSFMVDARGGSMRGSRHHGMRIIIPPRKCTAPTRITCRLVKRHKLANPPPMVEGEGLASRLVEMGPAGAQFLGPVIVEIPHFGSMRGKERELIVLRSENGETWKEHQFDSKNEDLAELLNGMDEGDKCTWFKIPKVQEVLVKSEDAITGDTDKYLGPQDLKELGDDSLPAEGYVGFSLGARSASLRSFSSDRSYTLNRSSYARDSMMIEELLVPSKEQHLTFTREFDSDSLRHYSWAADTLDNVNLVSSPVHSGFLVSFMVDARGGSMRGSRHHGMRIIIPPRKCTAPTRITCRLVKRHKLANPPPMVEGEGLASRLVEMGPAGAQFLGPVIVEIPHFGSMRGKERELIVLRSENGETWKEHQFDSKNEDLAELLNGMDE

IRESfinder result

IRESfinder score

0.366137285

IRES/non IRES

non-IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page