top of page

mmu_circAnk2_818

Basic information of circular RNA
PanCircBase ID:

mmu_circAnk2_818

mm39_Chr. Position ID:

chr3|126726586|126731518|-

Gene name:

Ank2

Transcript:

ENSMUST00000044443.15

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

4

Exon/intron indexes:

21,20,19,18

Exon/intron offsets:

0,1588,3682,4800

Genomic length:

4932

Exon/intron sizes in nt:

289,253,144,132

Flanking exon/introns:

chr3:126723730-126726586|chr3:126731518-126733720

Splice length:

818

Other database IDs:

circAtlas: mmu-Ank2_0147

circBase: hsa_circ_0125108, circAtlas: hsa-ANK2_0006, CIRCpedia: HSA_CIRCpedia_124105

Human Ortholog IDs:
Mature spliced Sequence:

AATTAGCAAGAGAACTGGATTTCACTGAGGAGCAAATTCACCAAATTCGAATCGAGAACCCCAACTCCCTTCAAGATCAGAGCCACGCACTGCTCAAGTACTGGCTGGAGAGGGATGGGAAGCATGCCACAGATACCATCCTCATCGAATGCCTCACCAAGATCAACAGGATGGACATTGTACATCTCCTGGAGACCAACACAGAGCCCCTCCAGGAGCGCATGGGCCGCAGCTATGCAGAAATAGAGCAGACCATTACGCTGGACCACAGTGAAGGATTTTCAGTCCTTCCAGACGAGCTCTGTGCTGCCAAGGAGAAGAAGGAGCAGGAAGCTTCCAAAGAAAGCGAGTCTAGCGACCACCCGCCCATGGTCTCCGAAGAAGACATATCTGTCGGTTATTCCACATTTCAGGATTGCCTCCCCAAAACTGAAGGGGACAGCCCAGCAGCAGCACTGTCTCCTCAAATGCACCAGGAGCCAGTTCAACAAGATTTCTCAGGGAAAACGCAAGACCAGCAGGAATATTATGTAACAACACCAGGGGCAGAAGTGGAAGACCCTCAGAAGGCCACAGCCGTTCCTGACTCTCTCTGTAAGACTCCTGAGGACATCAGTACCCCTCCTGAGGGAACAAAGCCTTGTCTCCAGACCCCGGTGACTAGCGAACGTGGTTCTCCGATTGTGCAAGAACCTGAGGAGGCTTCCGAGCCCAAAGAGGAGAGTTCTCCAAGGAAAACTAGCCTGGTCATTGTTGAGTCAACAGACGACCAGTCTCAGGTCTTTGAAAGACTGGATGGTGATGCCGCTTTTCAAAAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

AGCCTGGTCATTGTTGAGTCA

59.58

GAAGGGAGTTGGGGTTCTCG

60.04

150

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

AGCCTGGTCATTGTTGAGTCA

59.58

AGGGAGTTGGGGTTCTCGAT

60.25

148

PCR template sequence:

GGAGAGTTCTCCAAGGAAAACTAGCCTGGTCATTGTTGAGTCAACAGACGACCAGTCTCAGGTCTTTGAAAGACTGGATGGTGATGCCGCTTTTCAAAAGAATTAGCAAGAGAACTGGATTTCACTGAGGAGCAAATTCACCAAATTCGAATCGAGAACCCCAACTCCCTTCAAGATCAGAGCCACGCACTGCTCAAGTA

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

9

Interacting miRNAs (#binding sites)

mmu-miR-146a-5p(1), mmu-miR-203-3p(1), mmu-miR-125b-5p(1), mmu-miR-149-5p(1), mmu-miR-351-5p(1), mmu-miR-125a-5p(1), mmu-miR-190b-5p(1), mmu-miR-207(1), mmu-miR-670-5p(1)

siRNAs for circular RNA silencing
Junction sequence

CGCTTTTCAAAAGAATTAGCAAGAGA

siRNA sets

NA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCANK2_818_ORF_1

1.2067

0.288012506

0.94581952

654

ORF sequence:

ATGGACATTGTACATCTCCTGGAGACCAACACAGAGCCCCTCCAGGAGCGCATGGGCCGCAGCTATGCAGAAATAGAGCAGACCATTACGCTGGACCACAGTGAAGGATTTTCAGTCCTTCCAGACGAGCTCTGTGCTGCCAAGGAGAAGAAGGAGCAGGAAGCTTCCAAAGAAAGCGAGTCTAGCGACCACCCGCCCATGGTCTCCGAAGAAGACATATCTGTCGGTTATTCCACATTTCAGGATTGCCTCCCCAAAACTGAAGGGGACAGCCCAGCAGCAGCACTGTCTCCTCAAATGCACCAGGAGCCAGTTCAACAAGATTTCTCAGGGAAAACGCAAGACCAGCAGGAATATTATGTAACAACACCAGGGGCAGAAGTGGAAGACCCTCAGAAGGCCACAGCCGTTCCTGACTCTCTCTGTAAGACTCCTGAGGACATCAGTACCCCTCCTGAGGGAACAAAGCCTTGTCTCCAGACCCCGGTGACTAGCGAACGTGGTTCTCCGATTGTGCAAGAACCTGAGGAGGCTTCCGAGCCCAAAGAGGAGAGTTCTCCAAGGAAAACTAGCCTGGTCATTGTTGAGTCAACAGACGACCAGTCTCAGGTCTTTGAAAGACTGGATGGTGATGCCGCTTTTCAAAAGAATTAG

Peptide sequence:

MDIVHLLETNTEPLQERMGRSYAEIEQTITLDHSEGFSVLPDELCAAKEKKEQEASKESESSDHPPMVSEEDISVGYSTFQDCLPKTEGDSPAAALSPQMHQEPVQQDFSGKTQDQQEYYVTTPGAEVEDPQKATAVPDSLCKTPEDISTPPEGTKPCLQTPVTSERGSPIVQEPEEASEPKEESSPRKTSLVIVESTDDQSQVFERLDGDAAFQKN

IRESfinder result

IRESfinder score

0.525703681

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page