top of page

mmu_circAlkbh8_409

Basic information of circular RNA
PanCircBase ID:

mmu_circAlkbh8_409

mm39_Chr. Position ID:

chr9|3367863|3369914|+

Gene name:

Alkbh8

Transcript:

ENSMUST00000212294.2

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

2

Exon/intron indexes:

8,9

Exon/intron offsets:

0,1794

Genomic length:

2051

Exon/intron sizes in nt:

152,257

Flanking exon/introns:

chr9:3359590-3367863|chr9:3369914-3382693

Splice length:

409

Other database IDs:

CIRCpedia: MMU_CIRCpedia_16958, circAtlas: mmu-Alkbh8_0010

Human Ortholog IDs:
Mature spliced Sequence:

AATTACACCTCGAAAATTTGATACCGTCCAAGCGTCTGAGCAATTTAAAGGGGGAATAATCACCAGTGACATTGGAGACTTGACTTTAAGCAAGAGGGGAATGCGCACATCCTTTACGTTTAGAAAAGTGAGGCGAATGCCCTGCAATTGTAGTTACTCCTCAGTCTGCGACAGACAAAGGAAGGCCACACCTCCATCCCTTACAGAGAGCAGTAAAGAAGCATTGGAGTTAGAGCAAAAGCATGTCCATCAAGTGTACAATGAGATTGCAAGTCACTTCAGCAGCACAAGACATAGCCCATGGCCACGCATAGTAGAGTTCCTGAAAGCTTTGCCAAGTGGTTCCATAGTGGCAGATATCGGATGTGGAAATGGAAAATACCTTGGCATCAACAAGGACTTATATATG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

AGCTTTGCCAAGTGGTTCCA

60.4

TGTCACTGGTGATTATTCCCCC

59.76

153

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

AGCTTTGCCAAGTGGTTCCA

60.4

AGTCTCCAATGTCACTGGTGA

58.67

162

PCR template sequence:

CATAGTAGAGTTCCTGAAAGCTTTGCCAAGTGGTTCCATAGTGGCAGATATCGGATGTGGAAATGGAAAATACCTTGGCATCAACAAGGACTTATATATGAATTACACCTCGAAAATTTGATACCGTCCAAGCGTCTGAGCAATTTAAAGGGGGAATAATCACCAGTGACATTGGAGACTTGACTTTAAGCAAGAGGGGA

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

1

Interacting miRNAs (#binding sites)

mmu-miR-182-5p(1)

siRNAs for circular RNA silencing
Junction sequence

GGACTTATATATGAATTACACCTCGA

siRNA sets

GTAATTCATATATAAGTCC, TGTAATTCATATATAAGTC

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCALKBH8_409_ORF_1

0.4476

0.05761931

0.14028364

330

ORF sequence:

ATGCGCACATCCTTTACGTTTAGAAAAGTGAGGCGAATGCCCTGCAATTGTAGTTACTCCTCAGTCTGCGACAGACAAAGGAAGGCCACACCTCCATCCCTTACAGAGAGCAGTAAAGAAGCATTGGAGTTAGAGCAAAAGCATGTCCATCAAGTGTACAATGAGATTGCAAGTCACTTCAGCAGCACAAGACATAGCCCATGGCCACGCATAGTAGAGTTCCTGAAAGCTTTGCCAAGTGGTTCCATAGTGGCAGATATCGGATGTGGAAATGGAAAATACCTTGGCATCAACAAGGACTTATATATGAATTACACCTCGAAAATTTGA

Peptide sequence:

MRTSFTFRKVRRMPCNCSYSSVCDRQRKATPPSLTESSKEALELEQKHVHQVYNEIASHFSSTRHSPWPRIVEFLKALPSGSIVADIGCGNGKYLGINKDLYMNYTSKI

IRESfinder result

IRESfinder score

0.544805778

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page