top of page

mmu_circAldh3a2_1054

Basic information of circular RNA
PanCircBase ID:

mmu_circAldh3a2_1054

mm39_Chr. Position ID:

chr11|61141768|61156121|-

Gene name:

Aldh3a2

Transcript:

ENSMUST00000066277.10

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

7

Exon/intron indexes:

8,7,6,5,4,3,2

Exon/intron offsets:

0,2681,5796,7798,11276,13303,14121

Genomic length:

14353

Exon/intron sizes in nt:

1,00,16,71,42,11,82,09,00,000

Flanking exon/introns:

chr11:61139923-61141768|chr11:61156121-61157679

Splice length:

1054

Other database IDs:

circAtlas: hsa-ALDH3A2_0011, CIRCpedia: HSA_CIRCpedia_19639

Human Ortholog IDs:
Mature spliced Sequence:

AGTGAACTCAATGCATACAGTCATGAAGTCATTACCATCCTTGGAGAGATTGATTTTATGTTGGGGAATCTTCCTGAATTGGCTTCTGCGAGACCGGCTAAGAAGAACCTGCTAACCATGATGGATGAGGCCTACGTTCAGCCCGAGCCTCTGGGAGTCGTACTGATTATTGGAGCTTGGAATTACCCTTTCGTTCTTACCATGCAACCGCTGGTGGGAGCCATTGCTGCAGGAAATGCTGCCATTGTTAAGCCCTCAGAACTCAGTGAAAACACGGCCAAGATCTTGGCTGAACTCCTCCCTCAGTACTTAGACCAGGACCTGTATGCGATTGTTAATGGCGGTATCCCGGAAACCACGGAGCTTCTGAAGCAGCGGTTTGACCACATTCTCTATACAGGGAACACTGCAGTTGGAAAAATTGTCATGGAAGCTGCTGCCAAGCATCTGACCCCTGTGACCCTGGAACTCGGCGGGAAAAGCCCTTGTTACATTGACAGAGACTGTGATCTGGACGTGGCTTGCAGACGCATAGCCTGGGGAAAGTACATGAATTGTGGTCAAACCTGCATTGCTCCTGACTATATCCTGTGCGAAGCCTCCCTCCAGAATCAAATCGTACAGAAGATTAAGGAAACGGTGAAGGACTTTTATGGGGAAAACATAAAGGCTTCTCCTGACTATGAAAGGATCATCAATCTTCGTCACTTTAAGAGGTTACAAAGTCTGCTTAAAGGCCAGAAAATAGCTTTCGGTGGAGAGATGGATGAGGCCACACGCTACTTAGCCCCAACCATACTTACAGATGTTGATCCTAACTCCAAGGTGATGCAAGAAGAAATTTTTGGACCAATTCTTCCAATAGTGTCTGTGAAAAATGTAGACGAAGCCATAAATTTCATAAATGACCGTGAAAAGCCCCTGGCTCTCTACGTATTTTCTCGTAACAATAAGCTCATCAAACGGGTGATAGATGAGACCTCCAGTGGTGGAGTCACCGGCAATGATGTCATCATGCACTTCACTGTTAATTCTCTGCCCTTTGGAGGTGTGG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

AGTCACCGGCAATGATGTCA

59.68

TCGCAGAAGCCAATTCAGGA

59.68

153

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

TGGAGTCACCGGCAATGATG

60.39

TCGCAGAAGCCAATTCAGGA

59.68

156

PCR template sequence:

CTCATCAAACGGGTGATAGATGAGACCTCCAGTGGTGGAGTCACCGGCAATGATGTCATCATGCACTTCACTGTTAATTCTCTGCCCTTTGGAGGTGTGGAGTGAACTCAATGCATACAGTCATGAAGTCATTACCATCCTTGGAGAGATTGATTTTATGTTGGGGAATCTTCCTGAATTGGCTTCTGCGAGACCGGCTA

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

6

Interacting miRNAs (#binding sites)

mmu-miR-103-3p(1), mmu-miR-135a-5p(1), mmu-miR-33-5p(1), mmu-miR-411-3p(1), mmu-miR-107-3p(1), mmu-miR-452-3p(1)

siRNAs for circular RNA silencing
Junction sequence

TTTGGAGGTGTGGAGTGAACTCAATG

siRNA sets

TTGAGTTCACTCCACACCT, ATTGAGTTCACTCCACACC, CATTGAGTTCACTCCACAC

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCALDH3A2_1054_ORF_1

1.1025

0.225367971

0.997164323

1134

ORF sequence:

ATGAGACCTCCAGTGGTGGAGTCACCGGCAATGATGTCATCATGCACTTCACTGTTAATTCTCTGCCCTTTGGAGGTGTGGAGTGAACTCAATGCATACAGTCATGAAGTCATTACCATCCTTGGAGAGATTGATTTTATGTTGGGGAATCTTCCTGAATTGGCTTCTGCGAGACCGGCTAAGAAGAACCTGCTAACCATGATGGATGAGGCCTACGTTCAGCCCGAGCCTCTGGGAGTCGTACTGATTATTGGAGCTTGGAATTACCCTTTCGTTCTTACCATGCAACCGCTGGTGGGAGCCATTGCTGCAGGAAATGCTGCCATTGTTAAGCCCTCAGAACTCAGTGAAAACACGGCCAAGATCTTGGCTGAACTCCTCCCTCAGTACTTAGACCAGGACCTGTATGCGATTGTTAATGGCGGTATCCCGGAAACCACGGAGCTTCTGAAGCAGCGGTTTGACCACATTCTCTATACAGGGAACACTGCAGTTGGAAAAATTGTCATGGAAGCTGCTGCCAAGCATCTGACCCCTGTGACCCTGGAACTCGGCGGGAAAAGCCCTTGTTACATTGACAGAGACTGTGATCTGGACGTGGCTTGCAGACGCATAGCCTGGGGAAAGTACATGAATTGTGGTCAAACCTGCATTGCTCCTGACTATATCCTGTGCGAAGCCTCCCTCCAGAATCAAATCGTACAGAAGATTAAGGAAACGGTGAAGGACTTTTATGGGGAAAACATAAAGGCTTCTCCTGACTATGAAAGGATCATCAATCTTCGTCACTTTAAGAGGTTACAAAGTCTGCTTAAAGGCCAGAAAATAGCTTTCGGTGGAGAGATGGATGAGGCCACACGCTACTTAGCCCCAACCATACTTACAGATGTTGATCCTAACTCCAAGGTGATGCAAGAAGAAATTTTTGGACCAATTCTTCCAATAGTGTCTGTGAAAAATGTAGACGAAGCCATAAATTTCATAAATGACCGTGAAAAGCCCCTGGCTCTCTACGTATTTTCTCGTAACAATAAGCTCATCAAACGGGTGATAGATGAGACCTCCAGTGGTGGAGTCACCGGCAATGATGTCATCATGCACTTCACTGTTAATTCTCTGCCCTTTGGAGGTGTG

Peptide sequence:

MRPPVVESPAMMSSCTSLLILCPLEVWSELNAYSHEVITILGEIDFMLGNLPELASARPAKKNLLTMMDEAYVQPEPLGVVLIIGAWNYPFVLTMQPLVGAIAAGNAAIVKPSELSENTAKILAELLPQYLDQDLYAIVNGGIPETTELLKQRFDHILYTGNTAVGKIVMEAAAKHLTPVTLELGGKSPCYIDRDCDLDVACRRIAWGKYMNCGQTCIAPDYILCEASLQNQIVQKIKETVKDFYGENIKASPDYERIINLRHFKRLQSLLKGQKIAFGGEMDEATRYLAPTILTDVDPNSKVMQEEIFGPILPIVSVKNVDEAINFINDREKPLALYVFSRNNKLIKRVIDETSSGGVTGNDVIMHFTVNSLPFGGV

IRESfinder result

IRESfinder score

0.542742138

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page