top of page

mmu_circAkt3_1514

Basic information of circular RNA
PanCircBase ID:

mmu_circAkt3_1514

mm39_Chr. Position ID:

chr1|176859215|177076447|-

Gene name:

Akt3

Transcript:

ENSMUST00000111159.2

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

12

Exon/intron indexes:

13,12,11,10,9,8,7,6,5,4,3,2

Exon/intron offsets:

0,12125,18388,27684,35561,47124,48551,65317,71312,77977,99321,217026

Genomic length:

217232

Exon/intron sizes in nt:

103,88,215,129,123,69,66,132,145,112,126,206

Flanking exon/introns:

chr1:176853015-176859215|chr1:177076447-177085711

Splice length:

1514

Other database IDs:

CIRCpedia: MMU_CIRCpedia_12068

CIRCpedia: HSA_CIRCpedia_110913

Human Ortholog IDs:
Mature spliced Sequence:

GCTGAGTCATCACTAGAGAGTGGGAAGGGCGGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCGAATCCAAACCCTAAAACTGACCTGCAAAGCACCATTTCTCCAAGTTGGGGGGCTCAGAGGGGAGCCATCATGAGCGATGTTACCATTGTGAAAGAAGGTTGGGTTCAGAAGAGGGGAGAATATATAAAAAACTGGAGGCCAAGATACTTCCTTTTGAAGACAGATGGCTCATTCATAGGCTATAAGGAGAAACCTCAAGATGTGGACTTACCTTATCCCCTCAACAACTTCTCAGTGGCAAAATGTCAGTTAATGAAAACAGAACGACCAAAGCCAAATACATTTATTATCAGATGTCTTCAGTGGACCACTGTTATAGAGAGAACATTTCATGTAGATACACCAGAGGAAAGAGAAGAGTGGACGGAAGCTATCCAAGCCGTAGCCGACCGATTGCAGAGGCAAGAGGAGGAGAGGATGAATTGTAGCCCAACCTCACAGATTGATAATATAGGAGAAGAAGAGATGGATGCGTCTACAACCCATCATAAAAGAAAGACGATGAATGATTTTGACTATTTGAAACTACTAGGTAAAGGCACTTTTGGGAAAGTTATTTTGGTTCGAGAGAAGGCAAGTGGAAAATACTATGCTATGAAGATTCTGAAGAAAGAAGTCATTATTGCAAAGGATGAAGTGGCACACACTCTTACTGAAAGCAGAGTACTAAAGAACACCAGACATCCATTTTTAACATCCTTGAAATATTCCTTCCAGACAAAAGACCGTTTGTGTTTTGTGATGGAATATGTTAATGGCGGAGAGCTGTTTTTCCATTTGTCGAGAGAGCGAGTGTTCTCTGAGGACCGCACACGTTTCTATGGTGCAGAAATTGTCTCTGCTTTGGACTATCTACATTCTGGAAAGATTGTGTACCGTGATCTCAAGTTGGAGAATTTGATGCTAGATAAGGATGGCCATATAAAAATTACGGATTTTGGGCTTTGCAAAGAAGGGATCACAGATGCAGCTACCATGAAGACATTCTGTGGCACACCAGAGTACCTGGCACCAGAGGTATTAGAAGATAATGACTATGGCCGAGCCGTGGACTGGTGGGGCTTAGGTGTTGTCATGTATGAAATGATGTGTGGAAGGTTGCCTTTCTACAACCAGGATCATGAGAAACTCTTTGAATTAATACTAATGGAAGACATTAAATTCCCCCGAACACTCTCTTCAGATGCAAAATCATTGCTTTCAGGGCTCTTGATAAAGGATCCAAATAAACGCCTTGGTGGAGGGCCAGATGATGCAAAAGAAATCATGAGGCATAGTTTTTTTTCTGGAGTAAACTGGCAAGATGTATATGACAAAAAGCTTGTACCTCCTTTTAAGCCTCAAGTAACATCTGAAACAGACACCCGATATTTTGATGAAGAATTTACAGCTCAGACTATTACAATAACACCACCTGAAAAGT

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

ACATCTGAAACAGACACCCGA

59.31

GTTTGGATTCGCTGCTGCTG

60.46

176

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

AACATCTGAAACAGACACCCGA

59.9

GTTTGGATTCGCTGCTGCTG

60.46

177

PCR template sequence:

GTACCTCCTTTTAAGCCTCAAGTAACATCTGAAACAGACACCCGATATTTTGATGAAGAATTTACAGCTCAGACTATTACAATAACACCACCTGAAAAGTGCTGAGTCATCACTAGAGAGTGGGAAGGGCGGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCGAATCCAAAC

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

12

Interacting miRNAs (#binding sites)

mmu-miR-9-5p(1), mmu-miR-93-5p(1), mmu-miR-20a-5p(1), mmu-miR-17-5p(1), mmu-miR-203-3p(1), mmu-miR-433-3p(1), mmu-miR-382-5p(1), mmu-miR-29b-2-5p(1), mmu-miR-539-5p(1), mmu-miR-335-3p(1), mmu-miR-350-3p(1), mmu-miR-574-5p(1)

siRNAs for circular RNA silencing
Junction sequence

CCACCTGAAAAGTGCTGAGTCATCAC

siRNA sets

ATGACTCAGCACTTTTCAG, GATGACTCAGCACTTTTCA, TGACTCAGCACTTTTCAGG

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCAKT3_1514_ORF_1

0.8333

0.079545375

0.998287311

1359

ORF sequence:

ATGAGCGATGTTACCATTGTGAAAGAAGGTTGGGTTCAGAAGAGGGGAGAATATATAAAAAACTGGAGGCCAAGATACTTCCTTTTGAAGACAGATGGCTCATTCATAGGCTATAAGGAGAAACCTCAAGATGTGGACTTACCTTATCCCCTCAACAACTTCTCAGTGGCAAAATGTCAGTTAATGAAAACAGAACGACCAAAGCCAAATACATTTATTATCAGATGTCTTCAGTGGACCACTGTTATAGAGAGAACATTTCATGTAGATACACCAGAGGAAAGAGAAGAGTGGACGGAAGCTATCCAAGCCGTAGCCGACCGATTGCAGAGGCAAGAGGAGGAGAGGATGAATTGTAGCCCAACCTCACAGATTGATAATATAGGAGAAGAAGAGATGGATGCGTCTACAACCCATCATAAAAGAAAGACGATGAATGATTTTGACTATTTGAAACTACTAGGTAAAGGCACTTTTGGGAAAGTTATTTTGGTTCGAGAGAAGGCAAGTGGAAAATACTATGCTATGAAGATTCTGAAGAAAGAAGTCATTATTGCAAAGGATGAAGTGGCACACACTCTTACTGAAAGCAGAGTACTAAAGAACACCAGACATCCATTTTTAACATCCTTGAAATATTCCTTCCAGACAAAAGACCGTTTGTGTTTTGTGATGGAATATGTTAATGGCGGAGAGCTGTTTTTCCATTTGTCGAGAGAGCGAGTGTTCTCTGAGGACCGCACACGTTTCTATGGTGCAGAAATTGTCTCTGCTTTGGACTATCTACATTCTGGAAAGATTGTGTACCGTGATCTCAAGTTGGAGAATTTGATGCTAGATAAGGATGGCCATATAAAAATTACGGATTTTGGGCTTTGCAAAGAAGGGATCACAGATGCAGCTACCATGAAGACATTCTGTGGCACACCAGAGTACCTGGCACCAGAGGTATTAGAAGATAATGACTATGGCCGAGCCGTGGACTGGTGGGGCTTAGGTGTTGTCATGTATGAAATGATGTGTGGAAGGTTGCCTTTCTACAACCAGGATCATGAGAAACTCTTTGAATTAATACTAATGGAAGACATTAAATTCCCCCGAACACTCTCTTCAGATGCAAAATCATTGCTTTCAGGGCTCTTGATAAAGGATCCAAATAAACGCCTTGGTGGAGGGCCAGATGATGCAAAAGAAATCATGAGGCATAGTTTTTTTTCTGGAGTAAACTGGCAAGATGTATATGACAAAAAGCTTGTACCTCCTTTTAAGCCTCAAGTAACATCTGAAACAGACACCCGATATTTTGATGAAGAATTTACAGCTCAGACTATTACAATAACACCACCTGAAAAGTGCTGA

Peptide sequence:

MSDVTIVKEGWVQKRGEYIKNWRPRYFLLKTDGSFIGYKEKPQDVDLPYPLNNFSVAKCQLMKTERPKPNTFIIRCLQWTTVIERTFHVDTPEEREEWTEAIQAVADRLQRQEEERMNCSPTSQIDNIGEEEMDASTTHHKRKTMNDFDYLKLLGKGTFGKVILVREKASGKYYAMKILKKEVIIAKDEVAHTLTESRVLKNTRHPFLTSLKYSFQTKDRLCFVMEYVNGGELFFHLSRERVFSEDRTRFYGAEIVSALDYLHSGKIVYRDLKLENLMLDKDGHIKITDFGLCKEGITDAATMKTFCGTPEYLAPEVLEDNDYGRAVDWWGLGVVMYEMMCGRLPFYNQDHEKLFELILMEDIKFPRTLSSDAKSLLSGLLIKDPNKRLGGGPDDAKEIMRHSFFSGVNWQDVYDKKLVPPFKPQVTSETDTRYFDEEFTAQTITITPPEKC

IRESfinder result

IRESfinder score

0.532954353

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page